Article Figures & Data
Figures
- Fig. 1.
Identification of scaffoldin-like polypeptides fromB. cellulosolvens. Bc, Coomassie brilliant blue-stained SDS-PAGE-separated proteins from concentrated cell-free culture fluids; Ab, Western blot analysis using antibodies specific for the scaffoldin subunit from C. thermocellum; GSI, blotted protein bands cross-reacting with the GS-I lectin from G. simplicifolia. The relative molecular weights (103) of the designated bands are indicated.
- Fig. 2.
Domain organization of CipBc and overview of sequencing strategy. (A) Domain architecture of CipBc. The polypeptide chain includes 11 cohesins (Coh-1 through Coh-11), an internal CBD, linkers (black), a single C-terminal dockerin domain (D), and an N-terminal signal peptide (stripes). Restriction enzyme sites (E,EcoRI; H, HindIII; P, PstI; S,SacI) and a DNA scale bar are shown. (B) A 1.2-kb PCR fragment obtained with degenerate primers based on peptide sequencing. (C) Top, a 2.8-kb fragment obtained from a SacI genomic library; C1 to C3, subclones of SacI fragment C obtained by using HindIII. (D and E) Respective 2.5- and 2.2-kb fragments, amplified by two-step inverse PCR fromPstI-digested and self-ligated genomic DNA. (F) A 0.8-kb PCR product. (G and H) Respective 2- and 2.8-kb fragments, amplified by genomic-walking PCR from the PstI-pUC19 minigenomic library. (I) A 0.5-kb fragment, amplified from the EcoRI-pUC19 minigenomic library. (J and K) Respective 1.1- and 1.2-kb PCR fragments, obtained from genomic DNA. (B to K) An “F” label on a primer indicates forward; “R” indicates reverse direction. Two primers shown on one end indicate two-step PCR. Arrows indicate the location and direction of primers. Dotted lines indicate a cyclic DNA fragment. Broken lines indicate the pUC19 vector. For primer sequences, see Table 1.
- Fig. 3.
Nucleotide and deduced amino acid sequences of theB. cellulosolvens scaffoldin subunit (CipBc). The presumed beginning of each cohesin, CBD, or dockerin domain is labeled. The signal sequence is shown in italics, and the intermodular linker sequences are underlined. Primer sequences are boxed, and their directionality is indicated by an arrow.
- Fig. 4.
Assignment of the B. cellulosolvens cohesins as type II cohesins. (A) Phylogenetic analysis of CipBc cohesin sequences. The type I cohesins include those from the other known scaffoldins and two other cellulase-binding surface proteins (OlpA fromC. thermocellum and OrfX from C. cellulolyticum). In addition to the CipBc cohesins, type II cohesins include the anchoring proteins from C. thermocellum and a putative anchoring protein from A. cellulolyticus. See Materials and Methods for sources of the sequences and abbreviations used in this and subsequent figures. The scale bar in this and subsequent figures indicates percentage (0.1) of amino acid substitutions. (B) Alignment of CipBc cohesin sequences versus types I and II cohesins (Coh-I and Coh-II, respectively). The positions of the β strands, known from the crystal structure of type I cohesins from C. thermocellum, are also shown. The sequence for cohesin 5 (Bc_coh-5) is shown as representative of the 11 B. cellulosolvens cohesins. The conserved sequence identities, similarities, and gaps of the B. cellulosolvens cohesins coincide with those of the type II cohesins.
- Fig. 5.
Relationship of the CipBc CBD to other scaffoldin and nonscaffoldin family III CBDs. (A) Sequence alignment of portions of selected family III CBDs, encompassing β-strands 4 through 7 (enumerated arrows). The CipBc CBD and the recently sequencedAcetivibrio CipV CBD (7) are compared to other known scaffoldin CBDs from family IIIa and nonscaffoldin family IIIb CBDs. Shaded residues indicate proposed cellulose-binding residues (39), and numbers refer to presumed positions on the mature CipBc protein. Dashes indicate gaps. (B) Phylogenetic analysis of the family III CBDs. Scaffoldin CBDs are shown as squares. The weighted centroid is shown as a shaded circle on the branch connecting the family IIIb and IIIc CBDs. This analysis is based on a similar analysis of family III CBDs (7).
- Fig. 6.
Relationship of the CipBc C-terminal dockerin with other dockerins of scaffoldin and nonscaffoldin origin. (A) Sequence alignment of the dockerin domain from CipBc with the type II dockerin from the CipA C. thermocellum scaffoldin and their relationship to selected type I dockerins from various cellulosomal enzyme subunits. Presumed calcium-binding residues are shaded, and proposed recognition residues are indicated in bold. (B) Phylogenetic analysis of selected dockerins. The dockerins included in panel A for sequence alignment are circled. Scaffoldin-borne dockerins are indicated by squares. The scale bar indicates percentage (0.1) of amino acid substitutions.
- Fig. 7.
Identification of cohesin-binding polypeptides derived from cellobiose-grown cells of B. cellulosolvens. (A) Coomassie brilliant blue-stained SDS-PAGE-separated proteins from cellulose-bound extracellular fraction. (B) Blot of gel in panel A, transferred electrophoretically onto nitrocellulose strips, probed with the His-tagged cohesin 5, and stained immunochemically, using an anti-His-tag antibody. Lanes: Bc, cellulose-adsorbed B. cellulosolvens proteins; Ct, purified cellulosome from C. thermocellum; Coh, purified recombinant type II cohesin 5, containing a His tag. The relative molecular weights (103) of the designated bands are indicated.
Tables
- Table 1.
Primers used in this study
Name Nucleotide sequencea Locationb Comments SEQ3-F ATNTTYGGNMGNACNTAYATGAAYYT Initially unspecified cohesin Degenerate primer derived from initial protease digest of candidate scaffoldin CBD-R TGWKYRWARTTWSWCCAGTC CBD Degenerate primer designed on the basis of known family III CBD sequences En-F TTRTCNACRTCRAADATCCA N terminus Degenerate primer that aligned with N-terminal portion of signal sequence 24C-R CATATTCAGGAGCTGATGCAT Coh-2 To amplify N terminus of CipBc 24N-R TTTTCTGCTGCTCCAGAATTC Coh-2 To amplify N terminus of CipBc H706N-R GTCTGTGATGGTGGTAGTGA Linker between Coh-3 and Coh-4 Sequencing H706N-F ATTGGTTCAGGTGTAACAGC Linker between Coh-3 and Coh-4 Sequencing COH-Fn CAGCTCGAGGGTTCAGGAGTAGTATCAACT Coh-5 Cohesin expression COH-Rn GTGGATCCTTACTATCCGTTTATTGAAGAAGCCTG Coh-5 Cohesin expression COH-F AGACCATGGGTTCAGGAGTAGTAGCAAC Coh-5 Cohesin expression COH-R AGTCTCGAGTCCGTTTATTGAAGAAGCCTG Coh-5 Cohesin expression, inverse PCR 12F1 TTAACAGCGACTTGAAGTT CBD Inverse PCR, sequencing 12R2 AGCTTGCTGCTGCACCATT CBD Inverse PCR, sequencing 12R1 GATCATATGTTGATGATCCTG CBD Inverse PCR, sequencing 12F2 CAATTCAGGGTAGAGTTGCA CBD Inverse PCR, sequencing SC-F GGTTCAACATCCATTAAGTTAG Coh-6 Genomic-walking PCR 3601-F ATGGAGTTCAGTTGGACAAT Coh-7 Sequencing 4041-F ACTGAAACTAAAGTATTATTGAA Coh-8 Sequencing C-R2 CAACAACTGGAGCATTAACT Linker between Coh-10 and Coh-11 Genomic-walking PCR C-R1 ATCATTATCAATAGCTGTCAA Coh-11 Genomic-walking PCR C-F1 TCACAAGGTGTATTGAACTT Coh-11 Genomic-walking PCR C-F2 GAACCTTTCAGCATACAGAG Coh-11 Genomic-walking PCR M13-R1 AGCGGATAACAATTTCACACAGGA pUC19 Genomic-walking PCR M13-R2 AACAGCTATGACCATGATTACG pUC19 Genomic-walking PCR M13-F1 GTTTTCCCAGTCACGACGTTG pUC19 Genomic-walking PCR M13-F2 TGTAAAACGACGGCCAGT pUC19 Genomic-walking PCR - Table 2.
Sequence of peptide fragment from cellulose-binding cell-derived components of B. cellulosolvens and its similarity to a conserved segment of family 48 glycosyl hydrolases
Bacterium Enzyme Sequence of fragment Bacteroides cellulosolvens “CelS”a WIFDVDNWYK Clostridium thermocellum CelSa WLMDVDNWYG Clostridium cellulolyticum CelFa WILDVDNWYG Clostridium josui CelDa WLLDVDNWYG Clostridium cellulovorans ExgSa WLLDVDNWYG Caldocellum saccharolyticum CelA WLMDVDNWYG Anaerocellum thermophilum CelA WLMDVDNWYG Clostridium stercorarium Cbh WLLDVDNWYG Cellulomonas fimi CbhB WLADVDNIYG ↵a Cellulosomal enzyme.
