Article Figures & Data
Figures
- Fig. 1.
Schematic map of the scr regulon of E. amylovora and the plasmids constructed for sequencing. The insertions S1 and S3 of Tn5seq are marked by ●. P, putative promoter; B, BamHI; E, EcoRI; EV,EcoRV; H, HindIII; M, MluI; Ps,PstI; S, SalI; Sm, SmaI; Sp,SphI.
- Fig. 2.
DNA mobility shift assay with promoter fragment PscrYAB and protein MBP-ScrR. Lane 1, no added protein; 2, 30 pmol of MBP-ScrR; 3, 50 pmol of MBP-ScrR; 4, 50 pmol of MBP-ScrR and 10 mM fructose; 5, 50 pmol of MBP-ScrR and 10 mM sucrose; 6, 50 pmol of MBP-ScrR and 10 mM glucose. The arrow indicates the promoter fragment with the bound 81-kDa protein MBP-ScrR. The double arrow indicates the unbound fragment.
- Fig. 3.
Induction of the scrYAB promoter fragment in Ea1/79(pSU18-Y1gfpR). (A) Expression dependent on sucrose concentration. Fluorescence measurements were done by flow cytometry. (B) Expression of the reporter gene fusion in the presence of various sugars and expression of the sucrose hydrolase activity of Ea7/74-LS7 grown in LB medium with 0.5% of each carbohydrate. The expression of the gfp reporter gene was determined by flow cytometry (dark bars) and spectrofluorometry (light bars). The sucrose hydrolase activity is shown in an intermediate bar color. Values for sucrose were set at 1.
- Fig. 4.
Flow cytometry of Ea1/79(pSU18-Y1gfpR) isolated from immature pears. (A) Comparison of the relative fluorescence of Ea1/79 (—·—) (background signals), Ea1/79(pSU18-Y1gfpR) isolated from immature pears (——), and Ea1/79(pSU18-Y1gfpR) isolated from immature pears which were soaked in 0.2% sucrose solution before inoculation (–––). Mean fluorescence values: Ea1/79(pSU18-Y1gfpR), 6.55; Ea1/79(pSU18-Y1gfpR) plus 0.2% sucrose, 8.87; Ea1/79, 1.26 (background). (B) Dot plot of forward (FSC) (x axis) and side (SSC) (y axis) scatter of the particles isolated from immature pears infected withE. amylovora. For measurement of bacterial fluorescence, region R1 was defined for optimal recovery of bacteria (95%).
- Fig. 5.
Growth of PD494Sm (light bars) and the sucrose mutant PD494-S1 (dark bars) in LB medium. The sucrose concentrations in the medium are indicated. Strain PD494Sm was used to avoid a slight interference by levan in determination of the cell density.
Tables
- Table 1.
Stains, plasmids, oligonucleotides, and phage used
Strain, plasmid, oligonucleotide, or phage Properties Source or reference E. coli GI698 F−lacIq lacPL8 ampC::PtrpcI Invitrogen S17-1 thi pro hsdR hsdM+ recA tra+ 47 E. amylovora Ea1/79 Wild-type strain isolated in 1979 in Germany 26 Ea7/74 Wild-type strain isolated in 1974 in Germany 26 Ea7/74-S1 Ea7/74scrY::Tn5seq1, Kmr This work Ea1/79-S3 Ea7/74scrA::Tn5seq1, Kmr This work PD494Sm Levan-deficient strain 12 PD494-S1 PD494SmscrY::Tn5seq1, Kmr This work Ea7/74-LS7 Ea7/74 with Tn5 insertion inlsc, Kmr 27 Plasmids pSU18 P15A replicon, lacZ′, Cmr, 2.3-kb polylinker pUC18 7 pGFPmut2 ColE1ori, 3.9 kb, Apr, pKEN2 derivative 20 pFG30 0.7-kbBamHI-PstI fragment from pGFPmut2 in pBlueSK+, 3.7 kb, Apr Fangchery Gonga pUC18 ColE1 replicon,lacZ′, Apr, 2.7 kb 55 pMAL-c2 Apr, expression vector New England Biolabs pQE31 ColE1 replicon, Apr, (His)6 tag Qiagen pVK100 IncP,mob+ cos, Tcr, Kmr 35 pSU18-Y1 0.25-kb PCR product with primers 3342 and 3341 from pSCR109 in pSU18,XbaI and SalI sites introduced, scrYABpromoter, Cmr This work pSU18-Y1gfp 0.7-kbXbaI-Asp718 fragment (with gfp) from pFG30 in pSU18-Y1, Cmr This work pSU18-Y1gfpR 1.2-kb PCR product with primers 3366 and 3367 from pSCR141 in pSU18-Y1gfp, EcoRV and Asp718 sites introduced, scrR+, Cmr This work pSCR100 Chromosomal 20-kb HindIII fragment from E. amylovora in pVK100,scrK+Y+A+B+R+ This work pSCR107 1.8-kb BamHI fragment from pSCR100 in pUC18, scrA′ scrB′, Apr This work pSCR109 3.9-kb BamHI fragment from pSCR100 in pUC18, scrK+ scrY+ scrA′, Apr This work pSCR141 4.1-kbHindIII-EcoRI fragment from pSCR100 in pUC18,scrB′ scrR+, Apr This work pQE31scrB 1.5-kb PCR product with primers 3584 and 3523 from pSCR100 in pQE31, SphI and HindIII sites introduced, scrB+, Apr This work pQE31scrR 1-kb PCR product with primers 3583 and 3506 from pSCR141 in pQE31, BamHI and HindIII sites introduced, scrR+, Apr This work pMalscrR 1-kb PCR product with primers 3583 and 3506 from pSCR141 in pMal-c2, BamHI and HindIII sites introduced, scrR+, Apr This work Oligonucleotidesb 3506 GCGAAGCTTTCACATGCCATTGCCGAAAGG (HindIII site) This work 3523 GCGAAGCTTATTAGGCGCGATGGATCGTAG (HindIII site) This work 3341 CGCGTCGACAGCCAGTAGCAGACATT (SalI site) This work 3342 CGCTCTAGAAACGCTTTCCCAGGTAATG (XbaI site) This work 3366 CGCGATATCCTGTGACAGTTCCAGCATTGAGA (EcoRV site) This work 3367 CGCGGTACCAGTCCTGCTTGTGTCGTTAATTG (Asp718 site) This work 3583 GCGGGATCCACTAAAAACAAACGTATTACCATTAAC (BamHI site) This work 3584 CGCGCATGCGAGCGAAGCCCATTTGCTGAAAC (SphI site) This work Bacteriophage λ::Tn5seq Tn5, Kmr, λ b221cI857, Pam80, Kmr, promoter sequences from SP6 and T7 39
