Article Figures & Data
Figures
- Fig. 1.
Arrangement of chb genes and mechanism of chitobiose transport by a PTS transporter. (A) Relative orientation of the celB (chbC), celC(chbA), and celA (chbB) genes on a portion of cp26, with arrows indicating direction of transcription. The orientation and approximate position of the insertion of gyrBr and deletion ofchbC constructed in the chbC72 mutation are also shown. The gyrBr gene is not drawn to scale. (B) Expected arrangement of Chb (or Cel) proteins and mechanism of chitobiose transport and utilization. The phosphate group is predicted to be donated by proteins common to all PTS systems, encoded by the chromosomal BB558, BB557, and BB448 genes (12). Cht, chitobiase. Modified from reference16.
- Fig. 2.
Growth of B31-A in medium containing various amounts of chitobiose (chi) substituting for GlcNAc. Complete BSKII medium contains 1.8 mM GlcNAc. Bacteria were diluted to 105/ml, grown at 35°C in the indicated media, and enumerated daily using a Petroff-Hausser chamber and dark-field microscope.
- Fig. 3.
Northern blot analysis of B31-4A RNA from bacteria before and after a temperature upshift. (A) chbC probe; (B) flaB probe. Arrowheads indicate the 1.4-kbchbC and 1-kb flaB mRNA positions; growth temperatures (degrees Celsius) of cultures from which RNA was prepared are indicated above the lanes. The exposure for the chbCprobe was approximately 10 times longer than that for theflaB probe.
- Fig. 4.
Southern blot analysis of the chbC region of wild-type and chbC72 bacteria. Undigested (−) orEcoRI-digested (R) plasmid DNA from B31-A orchbC72 was probed with gyrB orchbC PCR products. The wild-type gyrBgene is chromosomal, so it is not present in these DNA preparations. The chbC probe contains a single EcoRI site, yielding 1.3-kbp (no longer present on the gel) and 7.5-kbp fragments in B31-A. The insertion-deletion event leads to a net increase of 1.7 kbp in the sizes of cp26 and of the largerEcoRI fragment (which becomes 9.2 kbp). Sizes (in kilobase pairs) corresponding to migration positions of DNA standards are indicated on the left.
- Fig. 5.
Growth of B31-A and the chbC72 mutant in various media. (A) Growth in BSKII with and without yeastolate (ye). (B) Growth in BSKII with and without GlcNAc. (C) Growth in BSKII with and without GlcNAc, and with the substitution of chitobiose (chi) (1.8 mM) for GlcNAc. (D) Growth of low-passage B31-4A in BSKII with and without GlcNAc, and with the substitution of chitobiose (chi) (1.8 mM) for GlcNAc. E. Growth in BSKII with and without both yeastolate (ye) and GlcNAc. Bacteria were enumerated as for Fig. 2. Representative experiments are shown.
- Fig. 6.
Scanning (A to H) and transmission (I and J) electron microscopic appearance of B31-A (A, C, E, G, and I) andchbC72 (B, D, F, H, and J) bacteria at various times during growth in medium with or without GlcNAc. Bacteria are shown at 50 h, representing the first exponential phase (A, B, I, and J); at 100 h, representing the death phase (C and D); and at 215 h, representing the second exponential phase for wild type bacteria (E and F). (G and H) Spirochetes from cultures grown in complete BSKII for 215 h. Scale bars = 1 μm.
- Fig. 7.
Growth during first and second passages in BSKII without GlcNAc. B31-A bacteria were diluted to 105/ml in BSKII without GlcNAc, grown for 214 h (to the second exponential phase), and then diluted back to 105/ml in BSKII without GlcNAc (arrows). The same culture was also diluted into medium with GlcNAc, both at thet = 0 time point and at 214 h. Bacteria were enumerated as for Fig. 2.
- Fig. 8.
Northern blot analysis of RNA prepared from B31-A bacteria grown in BSKII medium lacking GlcNAc, with and without chitobiose supplementation. (A) Growth curves, with numbers (corresponding to lanes in B and C) and arrows indicating times at which RNA was prepared. The solid line indicates B31-A grown in complete BSKII medium, the dotted line indicates growth in BSKII without GlcNAc, and the dashed line indicates growth in BSKII lacking GlcNAc but supplemented with chitobiose. (B and C) Northern blot analysis of RNA from the indicated time points. Lanes: 1, bacteria grown in complete BSKII; 2, bacteria grown in BSKII without GlcNAc supplemented with 0.9 mM chitobiose; 3 to 5, bacteria grown in BSKII without GlcNAc, with RNA isolated from the first exponential phase, the death phase, and the second exponential phase, respectively. The blot was hybridized first with achbC probe (arrowhead in panel B) and then rehybridized with a flaB probe (arrowhead in panel C). The exposure for the chbC probe was approximately 10 times longer than that for the flaB probe. Densitometric comparison of the flaB hybridization signals indicated that lanes 1 and 2 contained threefold more RNA than lanes 3 to 5.
Tables
- Table 1.
Oligonucleotide primers used in this study
Primer Sequence (5′→3′) Use cp26-24974 CAGGACGACGTCCTATTGCC chbregion amplification cp26-20651 CCATCGATAAGAAACTTTTTATTAGTGC chb region amplification cp26-24116 CCAAGCTTAAGTTTTGCAATAGCAATTC Allelic exchange; screening gyrB-U178F-KpnI GGGGTACCTGTTGGTTTTAGCACTATA gyrBramplification gyrB-1905R-NcoI TGCCATGGTTACACATCAAGATTAATTAC gyrBramplification chbC-F TTAATTGCTTTAAGAGATGGC chbCprobe; screening chbC-R TACCATGAAGACCACAAAACC chbC probe FL-6 TTCAGGGTCTCAAGCGTCTTGGACT flaB probe FL-7 GCATTTTCAATTTTAGCAAGTGATG flaB probe
