Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Bacteriology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Plant Microbiology

Molecular Characterization of Global Regulatory RNA Species That Control Pathogenicity Factors in Erwinia amylovora and Erwinia herbicola pv. gypsophilae

Weilei Ma, Yaya Cui, Yang Liu, C. Korsi Dumenyo, Asita Mukherjee, Arun K. Chatterjee
Weilei Ma
Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yaya Cui
Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yang Liu
Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
C. Korsi Dumenyo
Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Asita Mukherjee
Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Arun K. Chatterjee
Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JB.183.6.1870-1880.2001
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

rsmBEcc specifies a nontranslatable RNA regulator that controls exoprotein production and pathogenicity in soft rot-causing Erwinia carotovora subsp.carotovora. This effect of rsmBEccRNA is mediated mostly by neutralizing the function of RsmAEcc, an RNA-binding protein of E. carotovora subsp. carotovora, which acts as a global negative regulator. To determine the occurrence of functional homologs of rsmBEcc in non-soft-rot-causingErwinia species, we cloned the rsmB genes ofE. amylovora (rsmBEa) and E. herbicola pv. gypsophilae (rsmBEhg). We show that rsmBEa in E. amylovorapositively regulates extracellular polysaccharide (EPS) production, motility, and pathogenicity. In E. herbicola pv. gypsophilae, rsmBEhg elevates the levels of transcripts of a cytokinin (etz) gene and stimulates the production of EPS and yellow pigment as well as motility. RsmAEa and RsmAEhg have more than 93% identity to RsmAEcc and, like the latter, function as negative regulators by affecting the transcript stability of the target gene. The rsmB genes reverse the negative effects of RsmAEa, RsmAEhg, and RsmAEcc, but the extent of reversal is highest with homologous combinations ofrsm genes. These observations and findings thatrsmBEa and rsmBEhg RNA bind RsmAEcc indicate that the rsmB effect is channeled via RsmA. Additional support for this conclusion comes from the observation that the rsmB genes are much more effective as positive regulators in a RsmA+ strain of E. carotovora subsp. carotovora than in its RsmA− derivative. E. herbicola pv. gypsophilae produces a 290-base rsmB transcript that is not subject to processing. By contrast, E. amylovora produces 430- and 300-base rsmB transcripts, the latter presumably derived by processing of the primary transcript as previously noted with the transcripts of rsmBEcc. Southern blot hybridizations revealed the presence of rsmB homologs inE. carotovora, E. chrysanthemi, E. amylovora, E. herbicola, E. stewartii and E. rhapontici, as well as in other enterobacteria such as Escherichia coli, Salmonella enterica serovar Typhimurium, Serratia marcescens, Shigella flexneri, Enterobacter aerogenes, Klebsiella pneumoniae, Yersinia enterocolitica, and Y. pseudotuberculosis. A comparison of rsmB sequences from several of these enterobacterial species revealed a highly conserved 34-mer region which is predicted to play a role in positive regulation by rsmBRNA.

In many host-pathogen systems, disease development requires coordinate expression of sets of genes in response to various signals and environmental cues (9, 13). Regulation of these genes, like that of the housekeeping genes, is subject to both transcriptional and posttranscriptional control. We have determined that posttranscriptional regulation mediated by the RsmA-rsmB pair is the most critical factor in soft-rot-causing Erwinia. RsmA is a small RNA binding protein, which acts by reducing the half-life of mRNA species (21, 33). rsmB specifies an untranslated regulatory RNA (21) and neutralizes the effect of RsmA. RsmA and rsmB RNA control many phenotypes in soft-rot-causing Erwinia, including the production of pectate lyase, polygalacturonase, cellulase, protease, harpin, motility, flagellum formation, antibiotic, pigment, elicitation of the HR (hypersensitive reaction), and pathogenicity (10, 26).Erwinia carotovora subsp. carotovora strain 71 produces two rsmB RNA species: a primary RNA of 479 bases which is processed to yield a 259-base RNA, designatedrsmB' RNA (21). The rsmB' RNA has the regulatory functions attributed to rsmB. Romeo and associates have identified a 360-base csrB RNA inEscherichia coli which is functionally very similar torsmB RNA, except that there is no evidence thatcsrB RNA is processed (33).

Preliminary trials with the cloned E. carotovora subsp.carotovora genes revealed transdominant regulatory effects of rsmA and rsmB genes in non-soft-rot-causingErwinia species such as E. amylovora, the representative of the Amylovora group (31), and E. stewartii and E. herbicola pv. gypsophilae, the representatives of the Herbicola group (31) (now members of the genus Pantoea [14]). Furthermore, homologs of rsmA exist in these bacteria and in all otherErwinia species tested (10). These observations prompted the hypothesis that the regulatory pair controls the production of pathogenicity factors in these non-soft-rot-causingErwinia species as well. We should note that pathogenicity of the Amylovora and Herbicola (Pantoea) groups of bacteria is determined not by extracellular enzymes, as in soft-rot-causingErwinia, but by factors such as extracellular polysaccharide (EPS) or growth hormones (4, 23). Since rsmBhomologs of these bacteria have not been examined, it was of interest to compare the structural and functional characteristics ofrsmB genes of the three groups of bacteria. We report here (i) cloning of rsmA and rsmB genes of E. amylovora (rsmAEa andrsmBEa) and E. herbicola pv. gypsophilae (rsmAEhg andrsmBEhg), (ii) nucleotide sequence or deduced amino acid sequence homologies of these genes, (iii) effects ofrsmA and rsmB in homologous and heterologous bacterial species, and (iv) reversal of the RsmA effect byrsmB. We also show that E. amylovora strain E9 produces two rsmB RNA species whereas E. herbicola pv. gypsophilae possesses a single rsmBtranscript species. Our findings and the physical evidence for the occurrence of RsmA homologs (10) suggest that the RsmA-rsmB regulatory system has been conserved in enterobacterial species. Moreover, we have identified a region ofrsmB RNA which has been conserved in enterobacterial species.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media.The bacterial strains and plasmids used in this study are described in Table1. The strains carrying drug markers were maintained on Luria-Bertani (LB) agar containing appropriate antibiotics. The wild-type strains were maintained on LB agar. The composition of LB medium, minimal salts medium, KB medium, nutrient gelatin (NG) agar, and polygalacturonate-yeast extract agar (PYA) have been described previously (2, 8). When required, antibiotics were supplemented as follows (in micrograms per milliliter): ampicillin, 100; kanamycin, 50; spectinomycin, 50; tetracycline, 10. Media were solidified by the addition of 1.5% (wt/vol) agar.

View this table:
  • View inline
  • View popup
Table 1.

Bacterial strains and plasmids used in this study

Extracellular enzyme assays.Growth conditions, preparation of culture supernatant, quantitative assay conditions for pectate lyase (Pel) and semiquantitative assay conditions for pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt) have been previously described (5, 29).

EPS production and motility assays.Cultures of E. herbicola pv. gypsophilae or E. amylovora were patched or streaked on minimal salts medium plus sucrose (1%, wt/vol) and spectinomycin for EPS detection and stab inoculated into KB soft agar (0.4%, wt/vol) plus spectinomycin with a needle for examination of motility. Bacteria were incubated at 28°C for 24 h. Motility and EPS production of the bacteria were visually examined.

Pathogenicity assays on apple shoots.Pathogenicity assays on apple shoots were carried out essentially as previously described (26), cell suspensions (30 μl containing 2 × 108 CFU) of E. amylovora strain E9 carrying thersmAEa+ plasmid,rsmBEa+ plasmid, or the cloning vector, pCL1920, were applied to the cut surface of each petiole. Inoculated plants were incubated at 28°C with a 14-h light/10-h dark regime until disease symptoms appeared.

DNA techniques.Standard procedures were used in the isolation of plasmid and chromosomal DNAs, transformation, restriction endonuclease digests, gel electrophoresis, and DNA ligation (34). Southern hybridizations were carried out as previously described (10). Restriction and modifying enzymes were obtained from Promega Biotec (Madison, Wis.). The Prime-a-Gene DNA labeling system of Promega Biotec was used for labeling DNA probes. PCR was performed as described by Liu et al. (21). By using the degenerate primers, DB1 (5′-YMADGGACACCTCCAGG-3′) and DB2 (5′-WCTGYRCYCCCGGTTCG-3′) (Y = C or T; M = A or C; D = A, G, or T; W = A or T; R = A or G), in thersmB sequence, we amplified the rsmB DNA in the following bacterial species: Pseudomonas fluorescens, Serratia marcescens, Shigella flexneri, Enterobactor arogenes, Salmonella enterica serovar Typhimurium, and Klebsiella pneumoniae(Table 1).

The plac-rsmB transcription fusions were constructed as follows. The 0.7-kb HincII-EcoRV fragment from pAKC1042 was cloned into the SmaI site of pCL1920 to produce pAKC1061, which contains plac-rsmBEhg. The 473-bp DNA fragment was amplified by PCR using theKpnI-tagged primer AGGGTACCGTTGCGAAGGAACAGCATG and HindIII-tagged primer AGAAGCTTAAAGGGGGCACTGTATAAACA and template DNA pAKC1043. After digestion with endonucleases, the DNA fragment was cloned into pCL1920 to produce pAKC1062 which carriesplac-rsmBEa. Similarly, pAKC1063, which containsplac-rsmB'Ea was constructed by cloning the 326-bp DNA fragment into pCL1920. The DNA fragment was amplified by PCR using the KpnI-tagged primer AGGGTACCTCTCCAGGATGGAGAAACG and theHindIII-tagged primer AGAAGCTTAAAGGGGGCACTGTATAAACA and template DNA pAKC1043 and digested with endonucleasesKpnI and HindIII. To construct pAKC1049 containing plac-rsmBEcc theKpnI-tagged primer AGGGTACCAAGTTAGTAACCGGTTACA and P7 primer GCAAGCTTCTTCACAACGTGGCGCTACAT (21) and template DNA pAKC679 were used for PCR. The 558-bp PCR product was digested with HindIII andKpnI and cloned into pCL1920.

RNA preparation and Northern hybridization.Bacteria were grown in 20 ml of LB or minimal salts medium supplemented with sucrose (0.5%, wt/vol) and appropriate antibiotics at 28°C to a turbidity of ca. 200 Klett units. Total RNA was then extracted by the method of Aiba et al. (1). The procedure used for Northern blot analysis was previously described (6, 22).

A 730-bp EcoRI fragment containing pre-etz andetz from pMBL-R.73 (17) was used as a probe. A 695-bp HincII-EcoRV fragment from pAKC1042 was used as the rsmBEhg probe. A 310-bpPstI-BglII fragment from pAKC1043 was used as thersmBEa probe. A 314-bpEcoRV-KpnI fragment from pAKC783 was used as thepel-1 probe (19). A 743-bpHindIII fragment from pAKC781 was used as thepeh-1 probe (19).

Primer extension analysis and RNase protection assay.Primer extension was performed as specified by the manufacturer (Promega Biotec). An aliquot (10 pmol) of primer EhgB1 (5′-TGCTCAATCCTGAGCGATCCTG-3′) (nucleotides [nt] +103 to +125) or EaP6 (5′-CTTCATCCTGAAGCCTGTCCCTG-3′) (nt +214 to +236) was end labeled with T4 polynucleotide kinase and [γ-32P]ATP. A 20-μg portion of total RNA fromE. herbicola pv. gypsophilae or E. amylovora and 100 fmol of 32P-labeled primer in 11 μl of primer extension buffer were incubated at 58°C for 20 min and cooled for 10 min at room temperature for annealing. Reverse transcription reaction was carried out with avian myeloblastosis virus reverse transcriptase at 42°C for 30 min.

The RNase protection assay was carried out as described by Liu et al. (20). The 272-bp rsmBEa DNA fragment (corresponding to at −62 to +194) amplified from pAKC1043 by PCR using BamHI-tagged primer EaP13 (5′-AGGGATCCAATAGCCTAAATAGCCGCTC-3′) andXbaI-tagged primer EaP15 (5′-AGTCTAGAATCCTGTTATCATCCATGAACTGCCG-3′) was cloned into pBluescript SK(+) to produce pAKC1044. XbaI-digested pAKC1044 was used as the template for in vitro transcription. The in vitro-synthesized RNA probes were labeled with [γ-32P]UTP by using T7 polymerase as specified by the manufacturer instructions (Promega Biotec). The DNA template was then removed from the RNA probes by DNase treatment. A 20-μg RNA sample from E. amylovora strain E9 and 105 cpm of RNA probe were incubated in 30 μl of hybridization buffer (80% formamide, 40 mM PIPES [pH 6.7], 400 mM NaCl, 1 mM EDTA) overnight at 45°C and then digested with 300 μl of RNase solution (10 mM Tris [pH 7.5], 5 mM EDTA, 300 mM NaCl, 40 μg of RNase A per ml, 2 μg of RNase T1 per ml) at 30°C for 1 h.

RNA stability assays.Cultures were grown at 28°C in minimal salts medium plus sucrose (0.5%, wt/vol) and spectinomycin to a turbidity of ca. 160 Klett units, and rifampicin was added to a final concentration of 200 μg/ml. Aliquots (10 ml) were collected at 0, 2.5, 5, 7.5, 10, and 15 min in tubes containing 5 ml of diethylpyrocarbonate-treated ice-cold water. Total RNA was extracted by the method of Aiba et al. (1), and Northern blot analysis was performed by the procedures described by Chatterjee et al. (6) and Liu et al. (22). After being washed, the blots were exposed to X-ray film. The Metamorph imaging system (Universal Imaging Corp.) was used for the densitometric analysis of the autoradiograms. All experiments were performed three times or more, and the results were reproducible.

RNA mobility shift assays.Using primersKpnI-tagged EaP10 (5′-AGGGTACCGTTGCGAAGGAACAGCATG-3′) and HindIII-tagged EaP12 (5′-AGAAGCTTAAAGGGGGCACTGTATAAACA-3′) orKpnI-tagged EhgB11 (5′-AGGGTACCACTGCAGGAGGCTCAGGAA-3′) and HindIII-tagged EhgB12 (5′-AGAAGCTTAAAGGGAGCACTGTATAAACA-3′), the PCR-amplified DNA fragment corresponding to nt +1 to +455 ofrsmBEa or nt +1 to +310 ofrsmBEhg was cloned in pBluescript SK(+) to produce pAKC1045 and pAKC1046. The rsmBEa andrsmBEhg RNA probes were synthesized in vitro from the HindIII-digested pAKC1045 and pAKC1046 DNAs by T7 RNA polymerase in the presence of [α-32P]UTP. The RNA-protein interaction was assayed in 20 μl of binding buffer (10 mM Tris-acetate [pH 7.5], 10 mM MgCl2, 50 mM NaCl, 50 mM KCl, 10 mM dithiothreitol, 5% [wt/vol] glycerol) containing 4000 cpm of labeled RNA (0.1 ng), with or without purified His6-tagged RsmAEcc and a 50-fold excess of unlabeled RNAs or yeast tRNA (Gibco BRL). After incubation for 30 min at room temperature, the reaction mixtures were loaded on a prerun 5% (wt/vol) polyacrylamide gel containing 5% (wt/vol) glycerol at 4°C. Electrophoresis was continued in 0.5× Tris-borate-EDTA (TBE) running buffer for another 4 h at 4°C. The gel was dried and exposed to X-ray film.

RESULTS AND DISCUSSION

As stated above, physical evidence has established the presence ofrsmA homologs in various enterobacterial species (10). Furthermore, several studies have revealed thatrsmA-rsmB and csrA-csrB work together to modulate gene expression in E. carotovora subsp.carotovora and Escherichia coli, respectively (18, 21). However, prior to this work, there was no evidence for RsmA-plus-rsmB-mediated gene regulation beyond these bacterial species. To alleviate this deficiency, we cloned and characterized rsmB genes from two Erwinia species that do not cause soft rot disease, i.e., E. amylovora andE. herbicola pv. gypsophylae, and obtained physical evidence for the occurrence of rsmB homologs in Erwiniaand other enterobacterial species.

Cloning of rsmB from E. herbicola pv. gypsophilae strain PD713 and E. amylovora strain E9.To clone the rsmB genes, genomic libraries of E. herbicola pv. gypsophilae strain PD713 and E. amylovorastrain E9 were transferred by triparental matings into E. carotovora subsp. carotovora strain Ecc71 or strain AC5071 carrying the E9 rsmA+ plasmid, pAKC120 (Table 1). Transconjugants were screened for protease production on nutrient gelatin agar medium, and colonies showing higher protease activity were tested for their levels of pectinase and cellulase activities. The clones showing higher levels of all these enzymes were presumed to carry rsmB+ plasmids. In this manner, we obtained several E9 and PD713 clones which produced elevated levels of enzymatic activities. Plasmid DNAs isolated from these colonies were subsequently analyzed by Southern blot hybridization under low-stringency conditions using the transcribed region ofrsmBEcc as the probe. One E9 clone and two clones from PD713 hybridized with the probe. By a subcloning and functional assay, the rsmBEhg gene was localized in a 1.7-kb HincII DNA fragment and thersmBEa gene was localized in a 1.7-kbBamHI DNA fragment.

Characterization of the rsmB genes of E. amylovora and E. herbicola pv. gypsophilae.To gain a better understanding of the structure and function of thersmB genes of E. amylovora and E. herbicola pv. gypsophilae, we determined the nucleotide sequences of the 1.7-kb BamHI fragment and the 1.7-kbHincII fragment that contain the E. amylovora rsmB gene (rsmBEa) and the E. herbicola pv. gypsophilae rsmB gene (rsmBEhg), respectively. A homology search revealed that the nucleotide sequences of rsmBEaand rsmBEhg have high similarities to those ofrsmBEcc of E. carotovora subsp.carotovora (21) and csrB ofEscherichia coli (see below and Fig.1A). LikecsrB (18) and rsmBEcc(21), the rsmBEa andrsmBEhg genes contain no apparent open reading frames, suggesting that they encode RNA regulators rather than protein products.

  • Open in new tab
  • Download powerpoint
  • Open in new tab
  • Download powerpoint
  • Open in new tab
  • Download powerpoint
Fig. 1.

(A) Alignment of the ribonucleotide sequences ofrsmB genes from E. amylovora strain E9 (Ea),E. herbicola pv. gypsophilae strain PD713 (Ehg), E. carotovora subsp. carotovora strain Ecc71(Ecc), andcsrB from Escherichia coli. Asterisks indicate identical amino acids, and dots indicate conserved substitutions. Arrows indicate the processed start sites ofrsmBEa RNA and rsmBEccRNA. The 34-mer consensus sequences in rsmB are shown against shaded backgrounds. The 7-base repeats are in boldface type. (B) Alignment of the deduced amino acid sequence of RsmA from E. herbicola pv. gypsophilae strain PD713, E. amylovorastrain E9, E. carotovora subsp. carotovora strain Ecc71, and CsrA from Escherichia coli.

To characterize rsmB RNAs, we performed Northern blot analyses. As shown in Fig. 2A, theE. herbicola pv. gypsophilae probe hybridized to a 290-base transcript. By contrast, with E9 total RNA, we detected two bands of about 300 and 430 bases. To further characterize the transcripts, we performed primer extension analysis (Fig. 2B) and RNase protection assays (data not shown). Using appropriate oligonucleotide primers, we detected that the 5′ end of rsmBEhg was positioned at a single adenosine residue and that two 5′ ends of thersmBEa transcripts, separated by 133 nt, were localized at the guanosine and thymidine residues, respectively (Fig.2B). Analysis of the 3′ sequence revealed that each rsmB RNA species contains a strong stem-loop structure (Fig. 1A), which can function as rho-independent transcription terminators as defined forrsmBEcc (21). Therefore, the sizes of rsmB RNA species, stretching from the 5′ ends identified by primer extension or RNase protection assays to their 3′ rho-independent terminators, are 310 nt forrsmBEhg and 317 and 451 nt for thersmBEa RNA species. These observations confirm that E. amylovora produces two rsmB transcripts, the shorter one spanning the 3′ end and the larger one extending further upstream of the shorter one (Fig. 2). We do not know the mechanism underlying the production of these two rsmB RNA species by E. amylovora. However, extrapolating from the findings with rsmBEcc (21), we consider it most likely that the 451-nt transcript represents the primary transcript whereas the 317-nt transcript is the processed product of the primary transcript. Since we have not detected sequences resembling typical enterobacterial promoters upstream of the 5′ end of the 317-base transcript, we consider it unlikely that the 451- and the 317-nt transcripts result from initiation of transcription from different start sites.

Fig. 2.
  • Open in new tab
  • Download powerpoint
Fig. 2.

(A) Northern blot analysis of rsmBtranscripts of E. herbicola pv. gypsophilae strain PD713 (lane 1) and E. amylovora strain E9 (lane 2). The positions of two rsmB transcripts of E9 are indicated by arrows. (B) Primer extension analysis of the 5′ ends of rsmB transcripts from E. herbicola pv. gypsophilae strain PD713 (a) andE. amylovora strain E9 (b). The portions of sequences pertinent to the 5′ ends are shown. The A residue in lane P1 is identified as the 5′ end of rsmB mRNA of PD713; the G and T residues in lane P2 are indicated as the two 5′ ends of rsmBmRNA of E9.

To determine the minimal size of rsmB required for its biological function, we constructed several plac-rsmBplasmids. In these constructs, the rsmB DNA fragments that do not carry the promoter regions were subcloned into the pCL1920 vector. Similar to the positive control pAKC1049 and pAKC1004 plasmids, which contain plac-rsmBEcc andplac-rsmB'Ecc, respectively, all of these constructs were able to not only stimulate extracellular Pel production in E. carotovora subsp. carotovora strain 71 and its RsmA-deficient derivative AC5071 but also reverse the negative effect of RsmA on extracellular Pel production (see Tables 2 and 3). These data allow several conclusions; (i) thersmBEa and rsmBEhg RNA species are biologically active and are responsible for the activation of extracellular enzyme production; (ii) these RNA species specifically act against the negative effect of RsmA; and (iii) the putative processedrsmB'Ea RNA species is still active, although it is less active than the primary rsmBEa RNA.

Our findings reported here and elsewhere (21) reveal two classes of rsmB genes. In one class, the larger primary transcript presumably is processed to yield a smaller and relatively stable RNA species. The other class comprises the rsmB genes that yield a small and stable RNA species not subject to processing. Moreover, based on our findings with strain Ecc71 rsmBtranscripts (21), we postulate that the primary transcript binds more RsmA molecules than the processed rsmB RNA does, thereby more effectively lowering the pool of free RsmA. In fact, the analysis of primary and secondary structures of RNA species (data not shown) clearly shows the availability of more putative RsmA binding sites in the primary transcript than in the processed RNA.

Analysis of rsmB and csrB RNA sequences.A database search revealed thatrsmBEa and rsmBEhg RNA sequences are homologs of rsmBEcc of E. carotovora subsp. carotovora (21) andcsrB of Escherichia coli (18). Alignment of the ribonucleotide sequences of rsmB fromE. carotovora subsp. carotovora, E. herbicola pv. gypsophilae, and E. amylovora, as well as csrB, is shown in Fig. 1A. In addition, phylogram analysis shows that thersmB RNAs of E. amylovora and E. herbicola pv. gypsophilae fall into a subgroup, suggesting thatrsmBEa and rsmBEhg may be evolutionarily and functionally closer. It also was evident that thersmBEa and rsmBEhg RNAs are genetically closer to the csrB RNA than to thersmBEcc RNA (data not shown). A noteworthy feature is that the homologies among these RNAs are higher at their 3′ ends than at the 5′ ends. While the last 100-base sequence ofrsmBEcc is critical for RNA stability, this sequence is not involved in regulating gene expression (21; Y. Liu and A. K. Chatterjee, unpublished data). Therefore, we propose that the 100-base sequence at the 3′ end, the most highly conserved sequence in the rsmB andcsrB RNAs, plays roles in the transcription termination and RNA stability due to its extremely stable stem-loop structure. Moreover, this RNA region does not possess the putative sequences that can be bound by RsmA and CsrA proteins (see below).

Liu et al. (18) proposed that CsrA binds csrBRNA, most probably to the 7-base repeats in the RNA molecules. The repeats contain the consensus sequence 5′-CAGGA(U/C)G-3′. Repeats carrying the identical consensus sequence also have been found within the rsmBEcc RNA as well as inrsmBEa RNA and rsmBEhgRNA (Fig. 1A), and there is evidence to suggest that these can be bound in vitro by purified RsmAEcc protein (18, 21). However, whether these sequences represent the specific recognition site for CsrA and RsmAEcc proteins is not known. Also, the significance of the sequences flanking the 7-base core sequence is unknown. A comparison of the rsmB and csrB RNA sequences reveals a 34-mer consensus sequence in each RNA species (Fig.3). The 34-mer sequence has the following specific characteristics in addition to the presence of the 5′-CAGGA(U/C)G-3′ sequence in the middle. (i) The 34-mer sequence is much longer than the previously determined 7-base 5′-CAGGA(U/C)G-3′ sequence. (ii) In each rsmB RNA species, only one copy of this 34-mer sequence exists, whereas additional 5′-CAGGA(U/C)G-3′ sequences are present as multiple modules in every RNA species, i.e., five copies inrsmBEhg, eight copies inrsmBEa, and nine copies inrsmBEcc and csrB. (iii) In instances where there is evidence for RNA processing, the 34-mer consensus sequence occurs in the rsmB′ RNA species, the 3′-end processed product of the primary transcripts. In Ecc71, thersmB′ RNA, rather than the 5′ region, is responsible for the regulatory role of rsmB RNA, i.e., the activation of exoprotein production (21). (iv) The 34-mer consensus sequence is predicted to carry a conserved secondary structure consisting of a 4-nt stem and a 5-nt [5′-AGGAA(U/C)-3′] loop (Fig. 3). Based on the specific features of the 34-mer consensus sequence, we propose this motif as the signature sequence for the growing rsmB/csrB regulatory RNA family. Indeed, a database search using the 34-mer consensus sequence revealed a single motif in the putative rsmB/csrB homolog of S. enterica serovar Typhimurium (accession number, gi 5730336) (Fig.3csrBSty). Furthermore, to test the proposal that the 34-mer motif is present in every rsmB homolog, degenerate primers were designed to be complementary to the nucleotide sequences within the 34-mer motif and to the 3′ terminator region. PCR analysis revealed amplification of rsmB DNA fragments fromSerratia marcescens, Shigella flexneri, andEnterobacter aerogenes; moreover, nucleotide sequence analysis confirmed that each PCR product carried one 34-mer motif (W. L. Ma and A. K. Chatterjee, unpublished data). These structural characteristics suggest that the 34-mer sequence represents an ancient motif arising prior to the evolutionary separation of the genera tested and that this motif is important for the basic biological function of the rsmB/csrB RNA regulator.

Fig. 3.
  • Open in new tab
  • Download powerpoint
Fig. 3.

Alignment of the 34-mer consensus sequences in thersmB RNA species of E. amylovora strain E9 (Ea),E. carotovora subsp. carotovora strain Ecc71 (Ecc), E. herbicola pv. gypsophilae strain PD713 (Ehg), andcsrB RNA of Escherichia coli (Eco), and S. enterica serovar Typhimurium (Sty). Positions refer to the nucleotide sequences relative to the 5′ of rsmB′ of E. amylovora and E. carotovora subsp.carotovora and 5′ of rsmB of E. herbicola pv. gypsophilae, Escherichia coli, andS. enterica serovar Typhimurium. Inverted arrows indicate the 4-nt stems of the stem-loop structure. The identical nucleotides of the 7-base repeats are in boldface type.

Effects of rsmBEhg in E. herbicola pv. gypsophilae and E. carotovora subsp.carotovora.To determine the effects of multiple copies of rsmBEhg, pAKC1042 containing thersmB gene or the vector pCL1920 was transformed intoE. herbicola pv. gypsophilae strain PD713 and E. carotovora subsp. carotovora strain Ecc71. The E. herbicola pv. gypsophilae constructs were tested for extracellular polysaccharide production and motility. As shown in Fig.4A, columns 1 and 2, multiple copies ofrsmBEhg activate EPS production and stimulate swarming motility in E. herbicola pv. gypsophilae strain PD713. Previous studies have shown that rsmBEccactivates pathogenicity factor production (21, 28). To ascertain if rsmBEhg would affect pathogenicity factors, such as phytohormones, we performed Northern blot analysis of the cytokinin (etz) genes in the E. herbicola pv. gypsophilae constructs. Total RNA samples of PD713 carrying pCL1920 or its rsmBEhg+derivative were hybridized with pre-etz plus etz(17) as the probe. The results show that two RNA bands of 1.4 and 1.0 kb hybridized with the probe, consistent with the previously reported pre-etz plus etz RNA profile of PD713 (17). Also, the levels of pre-etz andetz transcripts were higher with multiple copies ofrsmBEhg than with the vector control (Fig. 4B).

Fig. 4.
  • Open in new tab
  • Download powerpoint
Fig. 4.

Effects of multiple copies ofrsmBEhg and rsmAEhg inE. herbicola pv. gypsophilae strain PD713. (A) EPS production and motility of E. herbicola pv. gypsophilae strain PD713 carrying pCL1920 (cloning vector, column 1), pAKC1042 (rsmBEhg+, column 2), or pAKC891 (RsmAEhg+, column 3). (B) Northern blot analysis showing multiple-copy effects ofrsmAEhg and rsmBEhg onetz (cytokinin gene) transcripts in E. herbicolapv. gypsophilae strain PD713. Lanes: 1, PD713/pCL1920; 2, PD713/pAKC891; 3, PD713/pAKC1042. Each lane contained 15 μg of total RNA.

E. carotovora subsp. carotovora strain Ecc71 carrying the rsmBEhg+ plasmid or the cloning vector was tested for extracellular enzyme production. The bacteria were grown in minimal salts medium supplemented with sucrose (0.5%, wt/vol) and spectinomycin, and the culture supernatants were assayed for Pel, polygalacturonase (Peh), protease (Prt) and cellulase (Cel) activities. Figure 5 (columns 1 and 2) shows that Ecc71 carrying thersmBEhg+ plasmid produced higher levels of Pel, Peh, Prt, and Cel than did Ecc71 carrying the cloning vector pCL1920. The effects of rsmBEhg in both homologous and heterologous systems indicate thatrsmBEhg is functionally similar torsmBEcc (21) (Table 3).

Fig. 5.
  • Open in new tab
  • Download powerpoint
Fig. 5.

Effects of multiple copies ofrsmBEhg and rsmAEhg on extracellular enzyme production in E. carotovora subsp.carotovora strain Ecc71. Ecc71 carrying the cloning vector pCL1920 (column 1), pAKC1042 (rsmBEhg+, column 2), or pAKC891 (RsmAEhg+, column 3) were grown in minimal salts medium plus sucrose (0.5%, wt/vol) and spectinomycin to a turbidity of ca. 200 Klett units, and the culture supernatant was used for an agarose plate assay of Pel, Peh, Prt, and Cel activities. Each well contained 20 μl of culture supernatant.

Effects of rsmBEa in E. amylovora and E. carotovora subsp.carotovora.In studies similar to that withrsmBEhg described above, we determined the effects of multiple copies of rsmBEa gene inE. amylovora and E. carotovora subsp.carotovora. The rsmBEa+plasmid, pAKC1043, or the cloning vector, pCL1920, was transformed intoE. amylovora strain E9 and E. carotovora subsp.carotovora strain Ecc71. The E. amylovoraconstructs were tested for EPS production, motility, and pathogenicity on apple shoots. As shown in Fig. 6A (columns 1 and 2), E. amylovora E9 carrying multiple copies of rsmBEa produced copious amounts of EPS compared to E9 carrying the vector. The bacteria carrying pAKC1043 also were more motile on semisolid agar medium. Furthermore, compared to E9 carrying pCL1920, E9 carrying thersmBEa+ plasmid wilted apple shoots in a shorter time (data not shown). Like thersmBEhg gene, rsmBEaactivated the production of Pel, Peh, Cel, and Prt in E. carotovora subsp. carotovora strain Ecc71 (data not shown).

Fig. 6.
  • Open in new tab
  • Download powerpoint
Fig. 6.

Effects of multiple copies ofrsmBEa and rsmAEa inE. amylovora strain E9. (A) EPS production and motility ofE. amylovora strain E9 carrying pCL1920 (cloning vector, column 1), pAKC1043 (rsmBEa+, column 2), or pAKC893 (RsmAEa+, column 3). (B) Pathogenicity of E. amylovora strain E9 carrying the cloning vector pSF6 (B1) and the rsmAEa+plasmid pAKC120 (B2). E. amylovora strain E9 carrying the vector pSF6 caused the apple shoots to bent down and wilt, whereas E9 carrying the rsmAEa+ plasmid pAKC120 was nonpathogenic in apple shoots.

Neutralization of RsmA by rsmB.SincersmBEcc neutralizes the effect of RsmA inE. carotovora subsp. carotovora (21) and csrB neutralizes the effect of CsrA in Escherichia coli (18), it was of interest to determine if thersmB genes of E. amylovora and E. herbicola pv. gypsophilae also antagonize their own RsmA-like factors. For this propose, we cloned and sequenced the rsmAgenes from E. amylovora strain E9 and E. herbicola pv. gypsophilae strain PD713. Analysis of the nucleotide sequences of the two rsmA genes revealed that 183-bp open reading frames encode the putative RsmAEhg and RsmAEa proteins, each consisting of 61 amino acid residues. A homology search disclosed that RsmAEhg and RsmAEa have 93 and 95% identity to RsmAEcc, respectively (Fig. 1B). In E. carotovora subsp.carotovora strain Ecc71, the RsmAEhg+ plasmid pAKC891 repressed extracellular enzyme (Pel, Peh, Cel, and Prt) production as determined by agarose plate assays (Fig. 5, column 3, shows the suppressive effect of rsmAEhg). In addition, in E. herbicola pv. gypsophilae strain PD713, the RsmAEhg+ plasmid pAKC891 repressed EPS production, motility, and the levels of cytokinin transcripts (Fig.4A, columns 1 and 3, and Fig. 4B). Similarly, RsmAEa+ plasmid pAKC893 suppressed motility on semisolid medium and suppressed EPS production (Fig. 6A, columns 1 and 3) in E. amylovora strain E9. Moreover, E. amylovora strain E9 carrying rsmAEa cosmid pAKC120 was nonpathogenic in apple shoots (Fig. 6B). Since RsmAEhg and RsmAEa promote pel-1 andpeh-1 mRNA degradation in E. carotovora subsp.carotovora RsmA strain AC5071 (Fig.7), it is most likely that, like RsmAEcc and CsrA, these RsmA species also affect mRNA stability and consequently the cognate phenotypes.

Fig. 7.
  • Open in new tab
  • Download powerpoint
Fig. 7.

mRNA stability of pel-1 and peh-1in E. carotovora subsp. carotovora strain AC5071 (RsmA−) carrying pCL1920 (cloning vector, row a), pAKC891 (RsmAEhg+, row b), pAKC893 (RsmAEa+, row c), or pAKC880 (RsmAEcc+, row d). Rifampin (200 μg/ml) was added to the cultures at a turbidity of ca.160 Klett units, and RNA was extracted at 0 min (lane 1), 2.5 min (lane 2), 5 min (lane 3), 7.5 min (lane 4), 10 min (lane 5), and 15 min (lane 6). Northern hybridization was performed at 65°C with [α-P32]dATP-labeledpel-1 and peh-1 probes. Each lane in row a contained 5 μg of total RNA, and each lane in rows b, c, and d contained 30 μg of total RNA. The blots were exposed to X-ray film for 24 h and analyzed by densitometric scanning. The densitometric results (percentage of remaining mRNA) were plotted against time after rifampin treatment. The circles, squares, triangles, and diamonds represent AC5071 carrying pCL1920, pAKC891, pAKC893, or pAKC880, respectively.

The cloning of both the rsmA and rsmB genes ofE. amylovora strain E9 and E. herbicola pv. gypsophilae strain PD713 and the availability of a well-characterized RsmA− strain of E. carotovora subsp.carotovora (AC5071) made it possible for us to test the interaction of these genes. Each of the AC5071 derivatives carryingrsmAEcc, rsmAEa orrsmAEhg was transformed with pAKC1004 (plac-rsmB′Ecc), pAKC1049 (plac-rsmBEcc), pAKC1062 (plac-rsmBEa), pAKC1063 (plac-rsmB′Ea), pAKC1061 (plac-rsmBEhg), or vector pCL1920. The bacterial constructs were assayed for extracellular Pel activity. The data in Table 2 show that the threersmB genes could reverse the repressive effects of all thersmA species; i.e., the genes are functional in heterologous systems. However, the efficiency of reversal of rsmB varies depending on the source of the rsmA species. WhilersmBEcc RNA was most effective in reversing the effect of RsmAEcc, it was least effective in neutralizing the effects of RsmAEa or RsmAEhg. On the other hand, each of these RsmA species was more effectively neutralized by the cognate rsmB RNA species. These observations imply a degree of specificity in RsmA-rsmB interaction. In this context, it is perhaps significant that rsmBEaand rsmBEhg RNA species belong to the same subgroup whereas rsmBEcc RNA belongs to another subgroup genetically distant from rsmBEa andrsmBEhg RNAs. These observations raise the possibility that structural differences among the three rsmBRNA species could account for the differential effects ofrsmB RNAs on RsmA species. Table 2 also shows that in the RsmAEcc− background, the suppressive effect on Pel production by the three rsmA species varied:rsmAEcc was most suppressive, followed byrsmAEa and then rsmAEhg. However, genetic variation among the three RsmA proteins is minor, with alterations mostly occurring within the last 6 amino acid residues within their C-terminal regions (Fig. 1B). It remains to be determined if the variations in RsmA proteins affect the binding specificity ofrsmB RNAs. However, we prefer the view that the differences among these rsmB RNA species probably determine the efficiency of interactions with RsmA species and the consequent extracellular Pel production. In addition, these differences in RNA may affect the RsmA-independent regulatory pathway(s) through whichrsmB acts to regulate gene expression (21).

View this table:
  • View inline
  • View popup
Table 2.

Reversal of negative effects of rsmA on extracellular Pel production by rsmB in RsmA−strain AC5071 of E. carotovora subsp.carotovora

To ascertain that the rsmB effects were mediated via RsmA, we compared the effects of plasmids carrying the rsmB genes in RsmA+ and RsmA− strains of E. carotovora subsp. carotovora. The data (Table3) show thatrsmBEa and rsmBEhg better stimulated enzyme production in RsmA+ bacteria than in the RsmA− strain. In RsmA− bacteria, the degrees of stimulation of Pel production were three- and twofold, which contrasts with six- and ninefold stimulation of Pel production in RsmA+ bacteria by the rsmBEa andrsmBEhg genes. Generally similar effects were seen with rsmBEcc, although the degree of stimulation in RsmA+ bacteria was much higher with this gene (80-fold stimulation) than with the rsmB genes fromE. amylovora (6-fold stimulation) or E. herbicolapv. gypsophilae (9-fold stimulation). These differences notwithstanding, the data allow the conclusion that rsmBactivates gene expression by neutralizing the RsmA effect. However, these results also indicate that rsmB RNA species play an additional regulatory role in the activation of extracellular enzyme production, which is RsmA independent.

View this table:
  • View inline
  • View popup
Table 3.

Multiple-copy effects of rsmB on extracellular Pel production in E. carotovora subsp. carotovorastrains Ecc71 (RsmA+) and AC5071 (RsmA−)

rsmB RNAs bind RsmAEcc.Previous studies with Escherichia coli and E. carotovorasubsp. carotovora have shown that RsmA/CsrA bindsrsmB RNA/csrB RNA (18, 21). Subsequent studies with E. carotovora subsp.carotovora have established that most of the regulatory effect of rsmB is channeled via RsmA. In light of the effects of rsmBEa andrsmBEhg on RsmAEcc, we considered it important to determine if RsmAEcc binds thesersmB RNA species. The results of gel mobility shift assays (Fig. 8) show that the purified RsmAEcc protein binds each of those two rsmB RNA species. The RsmAEcc-rsmB binding was prevented by the addition of excess unlabeled RNA to the reaction mixture (Fig.8, lanes 3 and 7). In addition, in vitro studies suggest specificity in the binding of RsmAEcc and these rsmB RNA species, since yeast tRNA had no effect on this binding (lanes 4 and 8).

Fig. 8.
  • Open in new tab
  • Download powerpoint
Fig. 8.

RNA mobility shift assay for binding of RsmAEcc to the rsmB RNAs. rsmB RNA probes of E. herbicola pv. gypsophilae and E. amylovora were synthesized from pAKC1046 and pAKC1045 in vitro by T7 RNA polymerase in the presence of [α-32P]-UTP. Labeled RNAs (0.1 ng, 4,000 cpm) were incubated without RsmA, with 5.0 ng of affinity-purified RsmA, with 5.0 ng of affinity-purified RsmA in the presence of a 50-fold excess of unlabeled probes, or with 5.0 ng of affinity-purified RsmA in the presence of a 50-fold excess of yeast tRNA. Lanes: 1, labeled rsmBEa RNA; 2, labeledrsmBEa RNA plus RsmAEcc; 3, labeledrsmBEa RNA plus RsmAEcc plus 50-fold unlabeled rsmBEa RNA; 4, labeledrsmBEa RNA plus RsmAEcc plus 50-fold yeast tRNA; 5, labeled rsmBEhg RNA; 6, labeledrsmBEhg RNA plus RsmAEcc; 7, labeledrsmBEhg RNA plus RsmAEcc plus 50-fold unlabeled rsmBEhg RNA; 8, labeledrsmBEhg RNA plus RsmAEcc plus 50-fold yeast tRNA.

Occurrence of rsmB homologs in Erwiniaspecies and other enterobacteria.It has been established thatrsmA occurs in enterobacteria and P. aeruginosa(38) and perhaps even in other bacteria such asBacillus subtilis and Haemophilus influenzae(12, 35). Our previous findings (28) have revealed that rsmBEcc (formerly aepH) occurs in E. carotovora subsp. carotovora andE. carotovora subsp. atroseptica strains. To examine if an rsmB homolog occurs in otherErwinia and enterobacterial species, we conducted Southern hybridizations with the rsmB probe from E. herbicola pv. gypsophilae strain PD713. The data (Fig.9) show thatrsmBEhg hybridized to all Erwinia and other enterobacterial species tested, indicating the presence ofrsmB homologs in these bacteria. To further strengthen this physical evidence, we used E. coli csrB as the probe. The same size bands that hybridized with the rsmBEaprobe also hybridized with the csrB probe (data not shown). These data demonstrate that rsmB sequences have been conserved in these bacteria. However, the differences in the sizes of the hybridizing fragments suggest that sequences of thersmB-like genes and the DNA flanking them may have diverged.

Fig. 9.
  • Open in new tab
  • Download powerpoint
Fig. 9.

Southern hybridization of EcoRI-digested chromosomal DNAs of Erwinia and other enterobacterial strains with rsmB of E. herbicola pv. gypsophilae strain PD713. Lanes: 1, E. chrysanthemi strain Ec16; 2,E. amylovora strain E9; 3, E. herbicola strain EH105; 4, E. herbicola pv. gypsophilae strain PD713; 5,E. rhapontici strain Erl; 6, E. stewartii strain DC283; 7, Escherichia coli strain K-12; 8, S. enterica serovar Typhimurium strain LT2; 9, Serratia marcescens strain Sm1; 10, Yersinia pseudotuberculosisstrain Yp1; 11, Shigella flexneri strain Sf1; 12,Enterobacter aerogenes strain Ena1; 13, Klebsiella pneumoniae strain Kp1. Southern hybridization was performed at 65°C. The blot was washed in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) for 15 min at room temperature followed by 30 min in 2× SSC–0.1% sodium dodecyl sulfate at 65°C. A 500-bpHincII-EcoRV fragment from pAKC1042 was used as the rsmBEhg probe.

In conclusion, we have characterized the rsmB genes cloned from E. amylovora and E. herbicola pv. gypsophilae. These genes have high levels of genetic, structural, and functional homology among themselves and to that of E. carotovora subsp. carotovora. The suppression of EPS production and pathogenicity of E. amylovora by RsmAEa, the inhibition of expression of a cytokinin gene inE. herbicola pv. gypsophilae by RsmAEhg, and the reversal of the negative effects of the RsmA species by thersmB genes in E. carotovora subsp.carotovora demonstrate that the rsmA-rsmB pairs play important regulatory roles in these bacteria. The fully conserved KH motifs in putative products of these rsmA genes strongly suggest that RsmAEa and RsmAEhg, like RsmAEcc, bind RNA species. Indeed, studies with thepel and peh genes suggest that RsmAEhg and RsmAEa affect mRNA stability, most probably by binding and promoting mRNA decay.rsmBEhg and rsmBEacounteract the RsmA effects, probably by reducing the pool of free RsmA due to the formation of a biologically inactive RsmA-rsmBribonucleoprotein complex. The occurrence of rsmB homologs in all enterobacterial species included in this study strongly suggests that many more bacteria employ this regulatory system to modulate their gene expression. This is clearly supported by the pleiotropic effect of RsmA of P. aeruginosa and P. fluorescens(3). Our work has also raised several other issues that await clarification. For example, what is the teleological significance of the processing of rsmB transcripts in some bacteria but not in others? Does RsmA binding prime RNAs for degradation by nucleases? Does RsmA act in conjunction with other factors which are responsible for the decay of specific transcripts? Since the RsmA-rsmB pair controls many factors important in bacterial ecology and in the production of useful metabolites, we expect that these and other issues will be resolved in the near future.

ACKNOWLEDGMENTS

Our work was supported by the National Science Foundation (grant MCB-9728505) and the Food for the 21st Century program of the University of Missouri.

We thank S. Manulis for E. herbicola pv. gypsophilae strains and the etz plasmid, and we thank Jeanne Erickson and Judy D. Wall for reviewing the manuscript.

FOOTNOTES

    • Received 21 August 2000.
    • Accepted 12 December 2000.
  • Copyright © 2001 American Society for Microbiology

REFERENCES

  1. 1.↵
    1. Aiba H.,
    2. Adhya S.,
    3. de Crombrugghe B.
    Evidence for two functional gal promoters in intact Escherichia coli.J. Biol. Chem.256198111190511910
    OpenUrl
  2. 2.↵
    1. Barras F.,
    2. Thurn K. K.,
    3. Chatterjee A. K.
    Resolution of four pectate lyase structural genes of Erweinia chrysanthemi (EC16) and characterization of the enzymes produced in Escherichia coli.Mol. Gen. Genet.2091987319325
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Blumer C.,
    2. Heeb S.,
    3. Pessi G.,
    4. Haas D.
    Global GacA-steered control of cyanide and exoprotease production in Pseudomonas fluorescens involves specific ribosome binding sites.Proc. Natl. Acad. Aci. USA9619991407314078
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. Bugert P.,
    2. Geider K.
    Molecular analysis of the ams operon required for exopolysaccharide synthesis of Erwinia amylovora.Mol. Microbiol.151995917933
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    1. Chatterjee A.,
    2. Liu Y.,
    3. Dumenyo C. K.,
    4. Chatterjee A. K.
    Inactivation of rsmA leads to overproduction of extracellular pectinases, cellulases, and proteases in Erwinia carotovora subsp. carotovora in the absence of the starvation/cell density-sensing signal, N-(3-oxohexanoyl)-l-homoserine lactone.Appl. Environ. Microbiol.61199519591967
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    1. Chatterjee A.,
    2. McEvoy J. L.,
    3. Chambost J. P.,
    4. Blasco F.,
    5. Chatterjee A. K.
    Nucleotide sequence and molecular characterization of pnlA, the structural gene for damage-inducible pectin lyase of Erwinia carotovora subsp. carotovora 71.J. Bacteriol.173199117651769
    OpenUrlAbstract/FREE Full Text
  7. 7.
    1. Chatterjee A. K.,
    2. Buchanan G. E.,
    3. Behrens M. K.,
    4. Starr M. P.
    Synthesis and excretion of polygalacturonic acid trans-eliminase in Erwinia, Yersinia, and Klebsiella species.Can. J. Microbiol.25197994102
    OpenUrlPubMed
  8. 8.↵
    1. Chatterjee A. K.,
    2. Thurn K. K.,
    3. Tyrell D. J.
    Isolation and characterization of Tn5 insertion mutants of Erwinia chrysanthemi that are deficient in polygalacturonate catabolic enzymes oligogalacturonate lyase and 3-deoxy-d-glycero-2,5-hexodiulosonate dehydrogenase.J. Bacteriol.1621985708714
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Cotter P. A.,
    2. Miller J. F.
    In vivo and ex vivo regulation of bacterial virulence gene expression.Curr. Opin. Microbiol.119981726
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Cui Y.,
    2. Chatterjee A.,
    3. Liu Y.,
    4. Dumenyo C. K.,
    5. Chatterjee A. K.
    Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-l-homoserine lactone, and pathogenicity in soft-rotting Erwinia spp.J. Bacteriol.177199551085115
    OpenUrlAbstract/FREE Full Text
  11. 11.
    1. Cui Y.,
    2. Mukherjee A.,
    3. Dumenyo C. K.,
    4. Liu Y.,
    5. Chatterjee A. K.
    rsmC of the soft-rotting bacterium Erwinia carotovora subsp. carotovora negatively controls extracellular enzyme and harpinEcc production and virulence by modulating levels of regulatory RNA (rsmB) and RNA-binding protein (RsmA).J. Bacteriol.181199960426052
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Fleischmann R. D.,
    2. Adams M. D.,
    3. White O.,
    4. Clayton R. A.,
    5. Kirkness E. F.,
    6. Kerlavage A. R.,
    7. Bult C. J.,
    8. Tomb J.-F.,
    9. Dougherty B. A.,
    10. Merrick J. M.,
    11. McKenney K.,
    12. Sutton G.,
    13. Fitzhugh W.,
    14. Fields C. A.,
    15. Gocayne J. D.,
    16. Scott J. D.,
    17. Shirley R.,
    18. Liu L.-I.,
    19. Glodek A.,
    20. Kelley J. M.,
    21. Weidman J. F.,
    22. Phillips C. A.,
    23. Spriggs T.,
    24. Hedblom E.,
    25. Cotton M. D.,
    26. Utterback T. R.,
    27. Hanna M. C.,
    28. Nguyen D. T.,
    29. Saudek D. M.,
    30. Brandon R. C.,
    31. Fine L. D.,
    32. Fritchman J. L.,
    33. Fuhrmann J. L.,
    34. Geoghagen N. S. M.,
    35. Gnehm C. L.,
    36. McDonald L. A.,
    37. Small K. V.,
    38. Fraser C. M.,
    39. Smith H. O.,
    40. Venter J. C.
    Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.Science2691995496512
    OpenUrlAbstract/FREE Full Text
  13. 13.↵
    1. Grant M.,
    2. Mansfield J.
    Early events in host-pathogen interactions.Curr. Opin. Plant Biol.21999312319
    OpenUrlCrossRefPubMedWeb of Science
  14. 14.↵
    1. Hauben L.,
    2. Moore E. R. B.,
    3. Vauterin L.,
    4. Steenackers M.,
    5. Mergaert J.,
    6. Verdonck L.,
    7. Swings J.
    Phylogenetic position of phytopathogens within the Enterobacteriaceae.Syst. Appl. Microbiol.211998384397
    OpenUrlCrossRefPubMedWeb of Science
  15. 15.
    1. Keen N. T.,
    2. Tamaki S.,
    3. Kobayashi D.,
    4. Trollinger D.
    Improved broad-host-range plasmids for DNA cloning in Gram negative bacteria.Gene.701988191197
    OpenUrlCrossRefPubMedWeb of Science
  16. 16.
    1. Lerner C. G.,
    2. Inouye M.
    Low copy number pasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white inset screening capability.Gene1819904631
    OpenUrl
  17. 17.↵
    1. Lichter A.,
    2. Barash I.,
    3. Valinsky L.,
    4. Manulis S.
    The genes involved in cytokinin biosynthesis in Erwinia herbicola pv. gypsophilae: characterization and role in gall formation.J. Bacteriol.177199544574465
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Liu M. Y.,
    2. Gui G.,
    3. Wei B.,
    4. Preston J. F. III,
    5. Oakford L.,
    6. Yueksel U.,
    7. Giedroc D. P.,
    8. Romeo T.
    The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli.J. Biol. Chem.27219971750217510
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    1. Liu Y.,
    2. Chatterjee A.,
    3. Chatterjee A. K.
    Nucleotide sequence and expression of a novel pectate lyase gene (pel-3) and a closely linked endopolygalacturonase gene (peh-l) of Erwinia carotovora subsp. carotovora 71.Appl. Environ. Microbiol.60199425452552
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    1. Liu Y.,
    2. Chatterjee A.,
    3. Chatterjee A. K.
    Nucleotide sequence, organization and expression of rdgA and rdgB genes that regulate pectin lyase production in the plant pathogenic bacterium Erwinia carotovora subsp. carotovora in response to DNA-damaging agents.Mol. Microbiol.1419949991010
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Liu Y.,
    2. Cui Y.,
    3. Mukherjee A.,
    4. Chatterjee A. K.
    Characterization of a novel RNA regulator of Erwinia carotovora ssp. carotovora that controls production of extracellular enzymes and secondary metabolites.Mol. Microbiol.291998219234
    OpenUrlCrossRefPubMedWeb of Science
  22. 22.↵
    1. Liu Y.,
    2. Murata H.,
    3. Chatterjee A.,
    4. Chatterjee A. K.
    Characterization of a novel regulatory gene aepA that controls extracellular enzyme production in the phytopathogenic bacterium Erwinia carotovora ssp carotovora.Mol. Plant-Microbe Interact.61993299308
    OpenUrlPubMedWeb of Science
  23. 23.↵
    1. Manulis S.,
    2. Havivchesner A.,
    3. Brandl M. T.,
    4. Lindow S. E.,
    5. Barash I.
    Differential involvement of indole-3-acetic acid biosynthetic pathways in pathogenicity and epiphytic fitness of Erwinia herbicola pv. gypsophilae.Mol. Plant-Microbe Interact.111998634642
    OpenUrlCrossRefPubMedWeb of Science
  24. 24.
    1. McEvoy J. L.,
    2. Murata H.,
    3. Chatterjee A. K.
    Molecular cloning and characterization of an Erwinia carotovora subsp. carotovora pectin lyase gene that responds to DNA-damaging agents.J. Bacteriol.172199032843289
    OpenUrlAbstract/FREE Full Text
  25. 25.
    1. Mukherjee A.,
    2. Cui Y.,
    3. Liu Y.,
    4. Chatterjee A. K.
    Molecular characterization and expression of the Erwinia carotovora hrpNEcc gene, which encodes an elicitor of the hypersensitive reaction.Mol. Plant-Microbe Interact.10199746271
    OpenUrlCrossRefPubMedWeb of Science
  26. 26.↵
    1. Mukherjee A.,
    2. Cui Y.,
    3. Liu Y.,
    4. Dumenyo C. K.,
    5. Chatterjee A. K.
    Global regulation in Erwinia species by Erwinia carotovora rsmA, a homologue of Escherichia coli csrA: repression of secondary metabolites, pathogenicity and hypersensitive reaction.Microbiology1421996427434
    OpenUrlCrossRefPubMedWeb of Science
  27. 27.
    1. Mukherjee A.,
    2. Cui Y.,
    3. Ma W.,
    4. Liu Y.,
    5. Chatterjee A. K.
    hexA of Erwinia carotovora ssp. carotovora strain Ecc71 negatively regulates production of RpoS and rsmB RNA, a global regulator of extracellular proteins, plant virulence and the quorum sensing signal, N-(3-oxohexanoyl)-l-homoserine lactone.Environ. Microbiol.22000203215
    OpenUrlCrossRefPubMedWeb of Science
  28. 28.↵
    1. Murata H.,
    2. Chatterjee A.,
    3. Liu Y.,
    4. Chatterjee A. K.
    Regulation of the production of extracellular pectinase, cellulase, and protease in the soft rot bacterium Erwinia carotovora subsp. carotovora: evidence that aepH of E. carotovora subsp. carotovora 71 activates gene expression in E. carotovora subsp. carotovora, E. carotovora subsp. atroseptica, and Escherichia coli.Appl. Environ. Microbiol.60199431503159
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    1. Murata H.,
    2. McEvoy J. L.,
    3. Chatterjee A.,
    4. Collmer A.,
    5. Chatterjee A. K.
    Molecular cloning of an aepA gene that activates production of extracellular pectolytic, cellulolytic, and proteolytic enzymes in Erwinia carotovora subsp. carotovora.Mol. Plant-Microbe Interact.41991239246
    OpenUrlCrossRefWeb of Science
  30. 30.
    1. Musco G.,
    2. Stier G.,
    3. Joseph C.,
    4. Morelli M. A. C.,
    5. Nilges M.,
    6. Gibson T. J.,
    7. Pastore A.
    Three-dimensional structure and stability of the KH domain—molecular insights into the fragile X syndrome.Cell851996237245
    OpenUrlCrossRefPubMedWeb of Science
  31. 31.↵
    1. Perombelon M. C. M.
    The genus Erwinia The prokaryotes: a handbook on the biology of bacteria. Ecophysiology, isolation, identification, applications. Balows A., Trüper H. G., Dworkin M., Schleifer K.-H. 1992 2899 2921 Springer-Verlag New York, N.Y
  32. 32.
    1. Politis D.,
    2. Goodman R. N.
    Fine structure of extracellular polysaccharide of Erwinia amylovora.Appl. Environ. Microbiol.401980596607
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Romeo T.
    Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB.Mol. Microbiol.29199813211330
    OpenUrlCrossRefPubMedWeb of Science
  34. 34.↵
    1. Sambrook J.,
    2. Fritsch E. F.,
    3. Maniatis T.
    Molecular cloning: a laboratory manual 2nd ed. 1989 Cold Spring Harbor Laboratory Press Cold Spring Habor, N.Y
  35. 35.↵
    1. Seldo B.,
    2. Lazarevic V.,
    3. Mauel C.,
    4. Karamata D.
    Sequence of the 305 degrees-307 degrees region of the Bacillus subtilis chromosome.Microbiology142199630793088
    OpenUrlCrossRefPubMed
  36. 36.
    1. Selvaraj G.,
    2. Fong Y. C.,
    3. Iyer V. N.
    A portable DNA sequence carrying the cohesive site (cos) of the bacteriophage lambda and the mob (mobilization) region of the broad-host-range plasmid RK2: a module for the construction of new cosmids.Gene321984235241
    OpenUrlCrossRefPubMedWeb of Science
  37. 37.
    1. Thurn K. K.,
    2. Chatterjee A. K.
    Isolation and protein composition of the outer membrane of Erwinia amylovora.Curr. Microbiol.719828792
    OpenUrl
  38. 38.↵
    1. White D.,
    2. Hart M. E.,
    3. Romeo T.
    Phylogenetic distribution of the global regulatory gene csrA among eubacteria.Gene1821996221223
    OpenUrlCrossRefPubMedWeb of Science
  39. 39.
    1. Zink R. T.,
    2. Kemble R. J.,
    3. Chatterjee A. K.
    Transposon Tn5 mutagenesis in Erwinia carotovora subsp. carotovora and E. carotovora subsp. atroseptica.J. Bacteriol.1571984809814
    OpenUrlAbstract/FREE Full Text
View Abstract
PreviousNext
Back to top
Download PDF
Citation Tools
Molecular Characterization of Global Regulatory RNA Species That Control Pathogenicity Factors in Erwinia amylovora and Erwinia herbicola pv. gypsophilae
Weilei Ma, Yaya Cui, Yang Liu, C. Korsi Dumenyo, Asita Mukherjee, Arun K. Chatterjee
Journal of Bacteriology Mar 2001, 183 (6) 1870-1880; DOI: 10.1128/JB.183.6.1870-1880.2001

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Bacteriology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Molecular Characterization of Global Regulatory RNA Species That Control Pathogenicity Factors in Erwinia amylovora and Erwinia herbicola pv. gypsophilae
(Your Name) has forwarded a page to you from Journal of Bacteriology
(Your Name) thought you would be interested in this article in Journal of Bacteriology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Molecular Characterization of Global Regulatory RNA Species That Control Pathogenicity Factors in Erwinia amylovora and Erwinia herbicola pv. gypsophilae
Weilei Ma, Yaya Cui, Yang Liu, C. Korsi Dumenyo, Asita Mukherjee, Arun K. Chatterjee
Journal of Bacteriology Mar 2001, 183 (6) 1870-1880; DOI: 10.1128/JB.183.6.1870-1880.2001
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS AND DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Bacterial Proteins
Erwinia
Gene Expression Regulation, Bacterial
RNA, Bacterial
RNA-binding proteins
Repressor Proteins
transcription factors

Related Articles

Cited By...

About

  • About JB
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jbacteriology

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0021-9193; Online ISSN: 1098-5530