Article Figures & Data
Figures
- FIG. 1.
Thermoplastic short-chain-length PHAs are synthesized from monomers with short side chains.
- FIG. 2.
Alignment of PhaZ1, PhaZ2, and PhaZ3 from R. eutropha. Black, identical; gray, highly conserved.
- FIG. 3.
PHB production and utilization in TSB medium. (A) Results for wt (○), ΔphaZ1 (⋄), ΔphaZ2 (□), and ΔphaZ3 (×) R. eutropha strains. (B) Results for wt (○), ΔphaZ1ΔphaZ2 (⋄), ΔphaZ1ΔphaZ3 (□), and ΔphaZ1ΔphaZ2ΔphaZ3 (×) R. eutropha strains.
- FIG. 4.
PHB production in PHB(high) medium by wt (○), ΔphaZ1 (⋄), ΔphaZ1ΔphaZ3 (□), and ΔphaZ1ΔphaZ2 (▵) R. eutropha strains. The production pattern is the same in all deletion strains (additional data not shown).
- FIG. 5.
PHB utilization in PHB (no carbon) medium. (A) Results for wt (○), ΔphaZ1(◊), ΔphaZ2(+), ΔphaZ1ΔphaZ3 (□), ΔphaZ2ΔphaZ3 (×), and ΔphaZ1ΔphaZ2 (▵) R. eutropha strains. (B) Results for wt (○), ΔphaZ1(◊), ΔphaZ3 (□), ΔphaZ1ΔphaZ3 (×), and ΔphaZ1ΔphaZ2ΔphaZ3 (▵) R. eutropha strains. These results are from an experiment independent of that corresponding to the results shown in panel A.
Tables
- TABLE 1.
Strains and plasmids used in this studya
Strain or plasmid Descriptionb Reference or source R. eutropha strains Ae H16 Wild-type; Gm resistant ATCC17699 Re1097 ΔphaZ1 strain, derived from Ae H16/pGY96 This study Re1107 ΔphaZ3 strain, derived from Ae H16/pPK51 This study Re1108 ΔphaZ1ΔphaZ3, strain, derived from Re1097/pPK51 This study Re1110 ΔphaZ2 strain, derived from AeH16/pJOE39 This study Re1111 ΔphaZ1ΔphaZ2ΔphaZ3 strain, derived from Re1108/pJOE39 This study Re1112 ΔphaZ1ΔphaZ2 strain, derived from Re1097/pJOE39 This study Re1113 ΔphaZ2ΔphaZ3 strain, derived from Re1107/pJOE39 This study E. coli strains DH5α Strain for ligation, cloning, and heterologous expression of PHA genes New England Biolabs DH5αF′ F′/endA1 hsdR17 glnV44 thi-1 recA1 gyrA relA1DU169 deoR 19 S17-1 recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 ATCC47055 Plasmids PBluescriptIIKS Cloning vector; LacZa Ap resistance Stratagene pCR2.1-TOPO High-copy-number plasmid used for cloning; confers Ap and Km resistance Invitrogen pJQ200mp 18Km Derivative of pJQ200mp 18; Gm resistance gene disrupted; confers Km resistance 21 pGY96 ΔphaZ1 gene replacement plasmid; confers Km resistance This study pJOE39 ΔphaZ2 gene replacement plasmid; confers Km resistance This study pPK51 ΔphaZ3 gene replacement plasmid; confers Km resistance This study pWt-250-2 ∼240-bp PCR product corresponding to phaZ1; cloned in pCR2.1-TOPO This study pZ15 ∼240-bp PCR product corresponding to phaZ2; cloned in pCR2.1-TOPO This study pZ31 ∼240-bp PCR product corresponding to phaZ3; cloned in pCR2.1-TOPO This study - TABLE 2.
Oligonucleotides used in this study
Purpose and oligonucleotides Sequencea Location and orientationb Probing intracellular depolymerases phaZB-3 GTSTAYRTBACXGAYTGG Degenerate oligonucleotides (degeneracy: 192) phaZB-4 GCRTCGATBGGVCCXSCSAT Degenerate oligonucleotides (degeneracy: 288) Inverse PCR phaZC1 AAGTGCCCGGCGTCAAGCG 5′ phaZ3 core sequence phaZC2 GCATATCGTGGCGGTTTGCC 3′ phaZ3 core sequence Library screening phaZB6 GCCGATCAGGTGCTGCACG 5′ phaZ2 core sequence phaZB10 GCGGGATCCCAAATCCCAGGTCCGGTGG 3′ phaZ2 core sequence Generation of deletion strains phaZ6 CCGGAGGATCCCGCAACAGGTGGCGAC 5′ end of region upstream of phaZ1 ORF (+) phaZ7 CGCAATCGCGGGCGTTTTCGCCTTTTCTGCCTGGGTCTA Fusion upstream and downstream of phaZ1 ORF (−) phaZ8 TAGACCCAGGCAGAAAAGGCGAAAACGCCCGCGATTGCG Fusion upstream and downstream of phaZ1 ORF (+) phaZ9 GCCGAGGATCCGCTGATCAACCCGGTGGTGG 3′ end of region downstream of phaZ1 ORF (−) phaZD1b CGTGCCAGGCATAAACTGATGGCCCCGGCAGCCGCCAGC Fusion upstream and downstream of phaZ2 ORF (−) phaZD2c AAAGGATCCCGAAGACAAAGGCAAAGGGGTAG 3′ end of region downstream of phaZ2 ORF (−) phaZD3b GCTGGCGGCTGCCGGGGCCATCAGTTTATGCCTGGCACG Fusion upstream and downstream of phaZ2 ORF (+) phaZD4b TTTGGATCCAGCCTTGGGGTGGATTTCATTC 5′ end of region upstream of phaZ2 ORF (+) phaZC8 GCCAAGGCGACGGAGCGCTGCGATTCCCGCCTTTTTG Fusion upstream and downstream of phaZ3 ORF (−) phaZC9 CAAAAAGGCGGGAATCGCAGCGCTCCGTCGCCTTGGC Fusion upstream and downstream of phaZ3 ORF (+) phaZC10 GGCCGGATCCACTTGATTGCAAGCTGCTCC 5′ end of region upstream of phaZ3 ORF (+) phaZC11 GGCCGGATCCTTATTCCGAGCACAAGTGCG 3′ end of region downstream of phaZ3 ORF (−) Deletion strain verification (additional oligonucleotides) phaZ2as AATGGCATGTTGATCGTTGGTG Upstream of phaZ2 ORF (−) phaZ2se CCTCCTTTACTGCTTGTTGCCG Downstream of phaZ2 ORF (+)
