PHYSIOLOGY AND METABOLISM

Ralstonia eutropha H16 Encodes Two and Possibly Three Intracellular Poly[d-(−)-3-Hydroxybutyrate] Depolymerase Genes

Gregory M. York, Joachim Lupberger, Jiamin Tian, Adam G. Lawrence, JoAnne Stubbe, Anthony J. Sinskey
DOI: 10.1128/JB.185.13.3788-3794.2003

Article Figures & Data

Figures

  • FIG. 1.
    FIG. 1.

    Thermoplastic short-chain-length PHAs are synthesized from monomers with short side chains.

  • FIG. 2.
    FIG. 2.

    Alignment of PhaZ1, PhaZ2, and PhaZ3 from R. eutropha. Black, identical; gray, highly conserved.

  • FIG. 3.
    FIG. 3.

    PHB production and utilization in TSB medium. (A) Results for wt (○), ΔphaZ1 (⋄), ΔphaZ2 (□), and ΔphaZ3 (×) R. eutropha strains. (B) Results for wt (○), ΔphaZ1ΔphaZ2 (⋄), ΔphaZ1ΔphaZ3 (□), and ΔphaZ1ΔphaZ2ΔphaZ3 (×) R. eutropha strains.

  • FIG. 4.
    FIG. 4.

    PHB production in PHB(high) medium by wt (○), ΔphaZ1 (⋄), ΔphaZ1ΔphaZ3 (□), and ΔphaZ1ΔphaZ2 (▵) R. eutropha strains. The production pattern is the same in all deletion strains (additional data not shown).

  • FIG. 5.
    FIG. 5.

    PHB utilization in PHB (no carbon) medium. (A) Results for wt (○), ΔphaZ1(◊), ΔphaZ2(+), ΔphaZ1ΔphaZ3 (□), ΔphaZ2ΔphaZ3 (×), and ΔphaZ1ΔphaZ2 (▵) R. eutropha strains. (B) Results for wt (○), ΔphaZ1(◊), ΔphaZ3 (□), ΔphaZ1ΔphaZ3 (×), and ΔphaZ1ΔphaZ2ΔphaZ3 (▵) R. eutropha strains. These results are from an experiment independent of that corresponding to the results shown in panel A.

Tables

  • TABLE 1.

    Strains and plasmids used in this studya

    Strain or plasmidDescriptionbReference or source
    R. eutropha strains
        Ae H16Wild-type; Gm resistantATCC17699
        Re1097ΔphaZ1 strain, derived from Ae H16/pGY96This study
        Re1107ΔphaZ3 strain, derived from Ae H16/pPK51This study
        Re1108ΔphaZ1ΔphaZ3, strain, derived from Re1097/pPK51This study
        Re1110ΔphaZ2 strain, derived from AeH16/pJOE39This study
        Re1111ΔphaZ1ΔphaZ2ΔphaZ3 strain, derived from Re1108/pJOE39This study
        Re1112ΔphaZ1ΔphaZ2 strain, derived from Re1097/pJOE39This study
        Re1113ΔphaZ2ΔphaZ3 strain, derived from Re1107/pJOE39This study
    E. coli strains
        DH5αStrain for ligation, cloning, and heterologous expression of PHA genesNew England Biolabs
        DH5αF′F′/endA1 hsdR17 glnV44 thi-1 recA1 gyrA relA1DU169 deoR19
        S17-1recA pro hsdR RP4-2-Tc::Mu-Km::Tn7ATCC47055
    Plasmids
        PBluescriptIIKSCloning vector; LacZa Ap resistanceStratagene
        pCR2.1-TOPOHigh-copy-number plasmid used for cloning; confers Ap and Km resistanceInvitrogen
        pJQ200mp 18KmDerivative of pJQ200mp 18; Gm resistance gene disrupted; confers Km resistance21
        pGY96ΔphaZ1 gene replacement plasmid; confers Km resistanceThis study
        pJOE39ΔphaZ2 gene replacement plasmid; confers Km resistanceThis study
        pPK51ΔphaZ3 gene replacement plasmid; confers Km resistanceThis study
        pWt-250-2∼240-bp PCR product corresponding to phaZ1; cloned in pCR2.1-TOPOThis study
        pZ15∼240-bp PCR product corresponding to phaZ2; cloned in pCR2.1-TOPOThis study
        pZ31∼240-bp PCR product corresponding to phaZ3; cloned in pCR2.1-TOPOThis study

    • ↵a Plasmids constructed in this study that were used only as intermediates for construction of other plasmids are described only in Materials and Methods.

    • ↵b Abbreviations: Ap, ampicillin; Gm, gentamicin; Km, kanamycin.

  • TABLE 2.

    Oligonucleotides used in this study

    Purpose and oligonucleotidesSequenceaLocation and orientationb
    Probing intracellular depolymerases
        phaZB-3GTSTAYRTBACXGAYTGGDegenerate oligonucleotides (degeneracy: 192)
        phaZB-4GCRTCGATBGGVCCXSCSATDegenerate oligonucleotides (degeneracy: 288)
    Inverse PCR
        phaZC1AAGTGCCCGGCGTCAAGCG5′ phaZ3 core sequence
        phaZC2GCATATCGTGGCGGTTTGCC3′ phaZ3 core sequence
    Library screening
        phaZB6GCCGATCAGGTGCTGCACG5′ phaZ2 core sequence
        phaZB10GCGGGATCCCAAATCCCAGGTCCGGTGG3′ phaZ2 core sequence
    Generation of deletion strains
        phaZ6CCGGAGGATCCCGCAACAGGTGGCGAC5′ end of region upstream of phaZ1 ORF (+)
        phaZ7CGCAATCGCGGGCGTTTTCGCCTTTTCTGCCTGGGTCTAFusion upstream and downstream of phaZ1 ORF (−)
        phaZ8TAGACCCAGGCAGAAAAGGCGAAAACGCCCGCGATTGCGFusion upstream and downstream of phaZ1 ORF (+)
        phaZ9GCCGAGGATCCGCTGATCAACCCGGTGGTGG3′ end of region downstream of phaZ1 ORF (−)
        phaZD1bCGTGCCAGGCATAAACTGATGGCCCCGGCAGCCGCCAGCFusion upstream and downstream of phaZ2 ORF (−)
        phaZD2cAAAGGATCCCGAAGACAAAGGCAAAGGGGTAG3′ end of region downstream of phaZ2 ORF (−)
        phaZD3bGCTGGCGGCTGCCGGGGCCATCAGTTTATGCCTGGCACGFusion upstream and downstream of phaZ2 ORF (+)
        phaZD4bTTTGGATCCAGCCTTGGGGTGGATTTCATTC5′ end of region upstream of phaZ2 ORF (+)
        phaZC8GCCAAGGCGACGGAGCGCTGCGATTCCCGCCTTTTTGFusion upstream and downstream of phaZ3 ORF (−)
        phaZC9CAAAAAGGCGGGAATCGCAGCGCTCCGTCGCCTTGGCFusion upstream and downstream of phaZ3 ORF (+)
        phaZC10GGCCGGATCCACTTGATTGCAAGCTGCTCC5′ end of region upstream of phaZ3 ORF (+)
        phaZC11GGCCGGATCCTTATTCCGAGCACAAGTGCG3′ end of region downstream of phaZ3 ORF (−)
    Deletion strain verification (additional oligonucleotides)
        phaZ2asAATGGCATGTTGATCGTTGGTGUpstream of phaZ2 ORF (−)
        phaZ2seCCTCCTTTACTGCTTGTTGCCGDownstream of phaZ2 ORF (+)

    • ↵a Restriction site (BamHI) engineered into sequences is indicated in bold lettering. Degenerate oligonucleotide code: B = T, C, G; R = A, G; S = C, G; V = A, G, C; X = T, C, A, G; Y = T, C.

    • ↵b Forward (+) or reverse (−) orientation relative to ORF is indicated.

Back to top
Download PDF
Citation Tools
Print

Alerts
Email

Related Articles

Cited By...