Article Figures & Data
Figures
- FIG. 1.
Construction of plasmids that express asRNA directed toward the downregulation of CoAT. (A) Construction of pCTFA2AS, pCTFB1AS, and pCOAT11AS. For each plasmid, the locations and directions of transcription of the relevant genes are indicated (arrows). Relevant restriction sites are shown. Abbreviations: thl promoter, promoter region for the thiolase gene of C. acetobutylicum strain ATCC 824; ctfA, CoAT subunit A gene; ctfB, CoAT subunit B gene; adc, AADC gene; MLSr, macrolide-lincosamide-streptogramin B resistance gene; repL, pIM13 origin of replication; AMPr, ampicillin resistance gene; ColE1, ColE1 origin of replication. All genes and plasmids are not drawn to scale. (B) Genetic organization of the sol operon. Abbreviations: aad, alcohol/aldehyde dehydrogenase structural gene; sol operon, polycistronic message that includes the mRNA for aad, ctfA, and ctfB. Lines with arrows represent the location and direction of each transcript.
- FIG. 2.
Downregulation of AADC in C. acetobutylicum adc-asRNA-expressing strains. (A) AADC Western blots from the transitional and stationary phases of fermentation. AADC bands as well as the closest marker bands are indicated for both blots. The culture phase from which the samples on each blot were taken is indicated below each blot. Lanes: 1, kaleidoscope-prestained marker from Bio-Rad Laboratories; 2, ATCC 824; 3, ATCC 824(pSOS95del); 4, ATCC 824(pADC38AS); 5, 824(pADC68AS); 6, 824(pADC100AS); 7, biotinylated protein marker from the horseradish peroxidase protein marker detection pack from New England Biolabs; 8, ATCC 824; 9, ATCC 824(pSOS95del); 10, ATCC 824(pADC38AS); 11, ATCC 824(pADC68AS); 12, ATCC 824(pADC100AS). (B) Percent downregulation of AADC in C. acetobutylicum adc-asRNA-expressing strains. The percent downregulation was calculated as the percent decrease of AADC gel band intensity in ATCC 824(pSOS95del) (▪), ATCC 824(pADC38AS) (□), ATCC 824(pADC68AS) (igwidth>), and ATCC 824(pADC100AS) (igwidth>) compared to that of the parental strain at the same culture phase in Western blots. The standard error of measurement was calculated from two to four different blots.
- FIG. 3.
Verification of the AADC band in Western blots. (A) Western blot with negative and positive controls for AADC expression. AADC and several of the closest marker bands (20.5, 28, and 37.5 kDa) are indicated. Lanes: 1 and 8, biotinylated protein marker from the horseradish peroxidase protein marker detection pack (New England Biolabs); 2, ATCC 824 at early exponential phase (2-liter bioreactor); 3, strain M5 at stationary phase (static-flask culture); 4, ATCC 824 at stationary phase (5-liter bioreactor); 5, ATCC 824 at transitional phase (5-liter bioreactor); 6, ATCC 824 at stationary phase (2-liter bioreactor); 7, ATCC 824 at transitional phase (2-liter bioreactor). (B) Improved detection of AADC in Western blots. (B.1) Western blot in which antibodies were added in the presence of blocking reagent. (B.2) Western blot in which the primary antibody was pretreated with crude extracts of strain M5 prior to incubation with the membrane. AADC and several of the closest marker bands (20, 30, and 40 kDa) are indicated. Lanes: 1 and 8, MagicMark Western protein standard Invitrogen; 2, ATCC 824(pADC100AS) at transitional phase; 3, ATCC 824(pADC68AS) at transitional phase; 4, ATCC 824(pADC38AS) at transitional phase; 5, ATCC 824(pSOS95del) at transitional phase; 6, strain M5 at stationary phase; 7, strain M5 at exponential phase.
- FIG. 4.
Predicted secondary structures of adc-asRNA. (A) adc38-asRNA; (B) adc68-asRNA; (C) adc100-asRNA. Examples of free nucleotides and components are shown for the asRNA of panel A. The first and last nucleotides of each asRNA molecule are designated F and L, respectively.
- FIG. 5.
Relationship between the component/nucleotide ratio and the percentage overall protein downregulation for asRNA in solventogenic clostridia. The different asRNA are represented by the following symbols: ▴, glna-asRNA; □, ptb-asRNA; ▪, buk-asRNA; •, adc38-asRNA; ○, adc68-asRNA;
, adc100-asRNA; ♦, ctfb1-asRNA; (⋄), coat11-asRNA-b. - FIG. 6.
Downregulation of CtfA and CtfB subunits of CoAT by CoAT-asRNA. (A) CoAT Western blots from the transitional, early stationary, and stationary phases of C. acetobutylicum static-flask fermentations. The CtfA and CtfB subunits of CoAT as well as the closest marker bands are indicated for all blots. The culture phase from which the samples on each blot were taken are indicated below each blot. Lanes 1, 5, and 10, biotinylated protein marker from the horseradish peroxidase protein marker detection pack from New England Biolabs; lanes 2, 6, and 11, ATCC 824(pSOS95del); lanes 3, 8, and 12, ATCC 824(pCTFB1AS); lane 7, degenerate ATCC 824(pSOS95del); lanes 4, 9, and 13, ATCC 824(pCOAT11AS). (B) Percent downregulation of CtfA and CtfB subunits of CoAT by CoAT-asRNA. The percent downregulation of CtfA and CtfB in ATCC 824(pCTFB1AS) (▪) and 824(pCOAT11AS) (□) was calculated as the percent decrease of the desired gel band intensity of Western blots in the asRNA-expressing strain compared to that in the plasmid control strain [824(pSOS95del)] at the same culture phase. The standard error of measurement was calculated from two to four different blots.
Tables
- TABLE 1.
Bacterial strains and plasmids
Bacterial strain or plasmid Relevant characteristic(s)a Reference or source Strain E. coli ER2275 NEBb E. coli OneShot chemically competent TOP10 Invitrogen C. acetobutylicum ATCC 824 ATCCc M5 AADC− CoAT− 4 Plasmid pAN1 Cmr; carries the φ3T I gene 17 pFNK6 Ampr MLSr; ace operon 18 pFNK7 Ampr MLSr ctfA ctfB 18 pSOS95 ace2 operon 30 pSOS95del Ampr MLSr; thl promoter This study pADC38AS Ampr MLSr; thl promoter; antisense adc38 This study pADC68AS Ampr MLSr; thl promoter; antisense adc68 This study pADC100AS Ampr MLSr; thl promoter; antisense adc100 This study pCTFA2AS Ampr MLSr; thl promoter; antisense ctfa2 This study pCTFB1AS Ampr MLSr; thl promoter, antisense ctfb1 This study pCOAT11AS Ampr MLSr; thl promoter; combined antisense ctfb1 and antisense ctfa1 This study ↵a adc, AADC gene; ctfA, CoAT subunit A gene; ctfB, CoAT subunit B gene; Cmr, chloramphenicol resistant; φ3T I, Bacillus subtilis phage φ3T I methyltransferase gene; Ampr, ampicillin resistant; MLSr, macrolide-lincosamide-streptogramin B resistant; ace operon, synthetic operon which contains the three homologous acetone formation genes (adc, ctfA, and ctfB) transcribed from the adc promoter; ctfA, gene encoding for the A subunit of CoAT; ctfB, gene encoding for the B subunit of CoAT; ace2 operon, synthetic operon which contains the three homologous acetone formation genes (adc, ctfA, and ctfB) transcribed from the thl promoter; thl promoter, promoter region for the thiolase gene (thl) of C. acetobutylicum strain ATCC 824; adc38, DNA fragment containing approximately 38% of the sequence of the adc transcript; adc68, DNA fragment containing approximately 68% of the sequence of the adc transcript; adc100, DNA fragment containing approximately 100% of the sequence of the adc transcript; ctfa2, DNA fragment containing approximately 79% of the ctfA structural gene; ctfb1, DNA fragment containing approximately 39% of the ctfB structural gene; ctfa1, DNA fragment containing approximately 53% of the ctfA structural gene.
↵b NEB, New England Biolabs (Beverly, Mass.).
↵c ATCC, American Type Culture Collection (Manassas, Va.).
- TABLE 2.
Oligonucleotides used for PCR
Primer Oligonucleotide sequencea (5′-3′) Use ADCUP GTAAATATAAATAAATAGGACTAGAGGCGA Upstream primer for adc38, adc68, and adc100 ADC38DOWN CTGTCCGCTTTCTGGATCCCAA Downstream primer for adc38 ADC68DOWN GCTTCATTAGCATCTAAGGCT Downstream primer for adc68 ADC100DOWN CACAGTTTAAAAAACCTCCAATCA Downstream primer for adc100 CTFAUP ATCTTAAATACTCGAGTTAAGAATTT Upstream primer for ctfa1 and ctfa2 CTFADOWN1 GATCCGCCTGCTCGAGTTGGATCCACTAGAG Downstream primer for ctfa1 CTFADOWN2 ATAGAAGGTGGATCCGGCCTCGAGTACAAT Downstream primer for ctfa2 CTFBUP AGCAATGACCCTCGAGTTCTTAT Upstream primer for ctfb1 CTFBDOWN1 CGAAAAATGTGCCGTCTCGAGGATCCGTTGT Downstream primer for ctfb1 ↵a Boldface letters in the oligonucleotide sequences indicate nucleotide substitutions used to generate useful restriction sites near the termini of the PCR products. Relevant restriction sites are underlined.
- TABLE 3.
Fermentation characteristicsa of strains for the asRNA downregulation of AADC in pH-controlled bioreactor experimentsb
Strain No. of expts Growth rate (h−1) Maximum A600 Acetone concn Acetone concn/maximum A600c Butanol concn Butanol concn/maximum A600c Peak acetate concn/maximum A600c Final acetate concn/maximum A600c Peak butyrate concn/maximum A600c Final butyrate concn/maximum A600c Butanol/acetate ratio ATCC 824 2 0.47 ± 0.07 7.63 ± 0.33 79 ± 4 10.4 ± 0.0 139 ± 9 18.2 ± 0.0 9.8 ± 0.0 9.1 ± 0.2 11.3 ± 0.4 6.4 ± 0.6 1.75 ± 0.03 ATCC 824(SOS95del) 6 0.45 ± 0.03 5.56 ± 0.42 49 ± 2 9.5 ± 1.0 93 ± 3 17.3 ± 1.6 15.9 ± 1.8 14.7 ± 1.2 13.4 ± 1.1 10.3 ± 0.7 1.91 ± 0.08 ATCC 824(pADC38AS) 2 0.43 ± 0.04 6.34 ± 0.04 50 ± 1 7.9 ± 0.2 118 ± 2 18.6 ± 1.8 17.2 ± 1.2 16.3 ± 0.9 11.9 ± 0.2 5.5 ± 1.8 2.34 ± 0.17 ATCC 824(pADC68AS) 2 0.42 ± 0.02 5.56 ± 0.19 47 ± 7 8.5 ± 0.9 101 ± 10 18.0 ± 1.1 17.4 ± 0.3 17.0 ± 0.5 14.2 ± 0.2 9.2 ± 0.7 2.14 ± 0.09 ATCC 824(pADC100AS) 2 0.44 ± 0.06 6.43 ± 0.42 73 ± 1 11.5 ± 0.9 141 ± 1 22.0 ± 1.6 15.9 ± 0.4 14.5 ± 0.4 12.5 ± 0.5 7.0 ± 0.2 1.92 ± 0.01 - TABLE 4.
Fermentation characteristicsa of strains for the asRNA downregulation of CoAT in static-flask culturesb
Strain No. of expts Maximum A600 Acetone concn/maximum A600c Butanol concn/maximum A600c Peak acetate concn/maximum A600c Final acetate concn/maximum A600c Peak butyrate concn/maximum A600c Final butyrate concn/maximum A600c ATCC 824(pSO595del) 2 5.43 ± 0.36 7.9 ± 0.9 15.4 ± 1.5 5.1 ± 0.3 4.3 ± 0.4 5.6 ± 0.3 1.9 ± 0.4 ATCC 824(pCTFA2AS) 2 4.26 ± 0.19 0.9 ± 0.01 4.8 ± 0.2 7.8 ± 0.5 8.2 ± 0.5 10.4 ± 0.6 10.4 ± 0.6 ATCC 824(pCTFB1AS) 2 4.03 ± 0.00 0.0 ± 0.0 2.7 ± 0.3 8.0 ± 0.0 7.8 ± 0.1 11.9 ± 0.2 11.9 ± 0.2 ATCC 824(pCOAT11AS) 2 4.28 ± 0.0 0.9 ± 0.5 4.6 ± 0.5 8.7 ± 0.1 5.9 ± 0.2 8.6 ± 0.4 8.4 ± 0.6
