Article Figures & Data
Figures
- FIG. 1.
(A) Organization of the bmp locus of B. burgdorferi and locations of primers, probes, and relevant restriction enzyme sites. The transcription start site of the bmpAB operon is indicated by a bent arrow, and the putative transcription terminator within bmpB is depicted by a hairpin. (B) Northern analysis of transcripts expressed from the bmp locus of B. burgdorferi. The lane containing bmpC is not shown, as no mRNA species was detected for this gene. (C) Characterization of the bmpAB RNAs by RNase H digestion. (D) Mapping of the bmpAB promoter by primer extension. The two dominant transcription start site A's at −30 and −32 are circled.
- FIG. 2.
Structure of the putative bmpB intragenic transcription terminator. The structure was identified by the DNASIS software. This software uses the method of Zuker and Stiegler (47) to predict RNA structures and calculate folding energies.
- FIG. 3.
Functional assessment of the bmpB IR sequence in B. burgdorferi. The effect of the terminator on gene expression was examined by inserting it into the coding region of gfp and analyzing the expression of the marker by Northern and Western blotting. Three individual transformants containing the wild-type construct (lanes 1 to 3) and three transformants containing the terminator-modified construct (lanes 4 to 6) were examined. Panels: A, agarose gel stained with ethidium bromide showing the total RNA profile from the six transformants; B, Northern blot probed with the gfp sequence; C, blot reprobed with the bmpB sequence, after removal of the gfp probe, to verify equal loading of RNA; D, Western blot developed with rabbit anti-GFP antibody.
- FIG. 4.
Identification of the BmpA, BmpB, and BmpD proteins and estimation of the relative expression of BmpA and BmpB in spirochetes cultured at 34°C. (A) Western blot showing the banding pattern of BmpA, BmpB, and BmpD. Three separate lanes from the same Western blot were developed with different anti-Bmp antibodies as follows: anti-BmpA monoclonal antibody (lane 1), polyclonal rhesus anti-BmpD antibody (lane 2), and mouse anti-BmpD polyclonal antibody (lane 3). The criterion used to deduce that the slowest-migrating band in lane 2 is BmpB is described in the text. (B) Western blot showing the expression of three Bmp proteins in four different 34°C cultures of B. burgdorferi JD1. The relative expression of the BmpA and BmpB proteins was quantified by densitometry.
- FIG. 5.
Reactivity of the rhesus anti-BmpD antibody to the rBmpA, rBmpB, and rBmpD proteins. (A) About 2 μg of each recombinant protein was electrophoresed through a 14% gel and stained with Coomassie G250. (B) Western blot assay of serial dilutions of rBmp proteins developed with a 1:200 dilution of the rhesus anti-BmpD antibody.
Tables
- TABLE 1.
Primers used in this study
Primer Sequencea Location Gene(s) or plasmid Use T9 5′ggaagatCTTGTTTTAAATCTAATAAAAAG3′ +47 to +69 bmpC Northern blotting T10 5′gcgcggatccTGCTTTAGTAGAAATGG3′ +43 to +59 bmpB Northern blotting T11 5′gcgcggatccTGTTCTAGCTCTGATGAT3′ +49 to +66 bmpD Northern blotting T12 5′catgccatggtTAAAATATTGTTGTTGATT3′ +6 to +24 bmpA Northern blotting T71 5′ggaagatctATGGCCAGCAAAGGAGAAGAACTT3′ +1 to +24 gfp pGEMT-gfp T72 5′gatcCTTTTTTGGCTGGCTATATTGCAGCCAAAAAAAGCTTTTCG3′ +428 to +468 bmpB Terminator T83 5′agtcgatgactcgagatcgatTTTACCGTTAAGCGCATGAA3′ −199 to −179 flaBp pQE30-flaBp T84 5′cgtttgaagaattcAAATGGAGAAGTGCTTTATATGA3′ pQE30 bmpB expression T87 5′AGGCGTATCACGAGGCCC3′ pQE30 pBVS2-flaBp-gfp(gfpT) T99 5′gtagcatgaggatccTGCTTTAGTAGAAATGGAATAG3′ +43 to +64 bmpB bmpB expression T101 5′atcgattcaggatccTGTAGTGGTAAAGGTAGTCTT3′ +52 to +72 bmpA bmpA expression B1 5′CTTGATCTTCATCAACTC3′ +736 to +719 bmpA RNase H B2 5′CCGTTAAAAATGCACCCT3′ +424 to +407 bmpA RNase H B6 5′aaactgcAGCTATATTTAAGTAGTTTA3′ +1077 to +1060 bmpC-bmpA Northern blotting B7 5′aaactgcaGTACTTCTATTTATTATA3′ +1111 to +1094 bmpB-BB381 Northern blotting B9 5′tcccaagcTTCACAAATCAGCTCAAT3′ +1054 to +1037 bmpD Northern blotting B13 5′GCTCCCAAGACTACCTTTACC3′ +78 to +58 bmpA Primer extension B67 5′ctagtctagaTTACGTTTCTCGTTCAGCTTTTTTG3′ +750 to +774 gfp pGEMT-gfp B75 5′gatcCGAAAAGCTTTTTTTGGCTGCAATATAGCCAGCCAAAAAAG3′ +468 to +428 bmpB Terminator B88 5′gtagcatgagaattcATGATAAAATTTAAATTTCTGACTT3′ −14 to −38 flaBp pQE30-flaBp B93 5′cgatagcatatcgatGTTCTTTACGATGCCATTGGGATAT3′ pQE30 pBVS2-flaBp-gfp(gfpT) B98 5′gcatgggctgcagTTAAATAAATTCTTTAAGAAACTTCT3′ +995 to +1020 bmpA bmpA expression B104 5′gtagcatgactgcagTTATAACTTTAATATTTGTTTTATAA3′ +1001 to +1026 bmpB bmpB expression B105 5′gccagaaAAGCTTTTTTTGGCTGCAATATAGCCCGCTAAGAAAGC3′ +464 to +427 bmpB bmpB expression ↵ a bmp sequences are in capitals, and unrelated sequences are in small letters. Functional restriction enzyme sites added to the primer are underlined. The three mutations in primer B105 are also underlined.
