Article Figures & Data
Figures
- FIG. 1.
Graphical demonstration of the content of the inserts in the five plasmids used to test for excision.
- FIG. 2.
Graphic depiction of the distances between important landmarks in making the transposon constructs. The different drawings are not done to scale. The numbers underneath the arrows represent the number of base pairs between the landmarks. The central point represents the end of the primer used to generate PCR products from within the different transposons. The distance between this point and the DR2 integrase binding sites is marked by the arrows terminating in solid circles. The distance between this point and the end of the transposon is marked by the arrows terminating in diamonds. The length of the entire PCR product is marked by the two-headed arrows. The bp 1 and integrase termini are indicated in the top diagram.
- FIG. 3.
Tn5386 termini observed in these experiments. Sequence in boldface represents Tn5386. The boxed “t” represents the truncated end observed in experiments looking at excisants from the genome of E. faecium D344R (9). The uppercase and boldface 6-bp sequences represent the junction sequences identified in previous experiments of Tn5386 excision from the E. faecium D344R genome. The colored lines above the sequence represent the termini observed in joint sequences when the bp 1 and/or integrase termini of Tn5386 were include in the excision complex. The colors correspond to the colors used to depict the termini in Fig. 4.
- FIG. 4.
Sequences of joint sequences of PCR products resulting from circularization of transposon constructs. The colored lines correspond to the termini designated by the colored lines in Fig. 3.
- FIG. 5.
Interactions between the Tn916 Int protein and the Tn916 direct repeat as discerned from NMR studies of the structure of the INT-DNA-binding domain-DNA complex by Wojciak et al. (14) (our figure is based on a similar figure from their publication). Arrows connect the INT-DBD residues to their DNA interaction sites. Open and closed circles represent phosphate and methyl groups that interact with INT-DBD, respectively. Residues and bases involved in hydrogen bonding are indicated by asterisks. The two residues that differ between the Int of Tn916 and Tn5386 in this region are indicated in parentheses, neither of which is involved in significant hydrogen bonding.
- FIG. 6.
Sequences of five of the aberrant Tn5386 integrase termini observed in this work. The consensus c-t-x-t sequence in each terminus is boxed.
Tables
- TABLE 1.
Bacterial strains and plasmids used in this study
Strain or plasmid Resistance phenotype or genotype or cloning vectora Description (source) Strains E. faecium D344R Apr Eryr Tcr Ampicillin-resistant clinical isolate (9) C68 Apr Eryr Gmr Tcr Vmr Clinical isolate; source for amplification of termini and flanking sequences of Tn5382 E. coli DH10B ΔM15 ΔlacX74 deoR recA1 araΔ139 Δ(ara leu)7697 galU galK ΔrpsL endA1 nupG Transformation-competent E. coli (Invitrogen) BL21(DE3) E. coli B F− dcm ompT hsdS(rB− mB−) gal λ(DE3) Strain used to express Tn916 or Tn5386 integrase or excisase-integrase behind T7lac promoter in pCDF-1b (Novagen) CJ236(NEB) FΔ(HindIII)::cat (Tra+ Pil+ Camr)/ung-1 relA1 dut-1 thi-1 spoT1 mcrA Strain used for cloning dUTP-containing PCR product into PCR-XL-TOPO (Invitrogen) EPI300 F− mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara leu)7697 galU galK λ− rpsL nupG trfA dhfr Strain used for maintaining copy control of pCC1 plasmids (Epicenter Biotechnologies) Plasmids pUC18 Apr Cloning vector pCR-XL-TOPO Kmr E. coli vector for cloning PCR products directly (Invitrogen) pCC1(Blunt) Cmr E. coli F-factor replicon (maintains one copy per cell) with an inducible high-copy oriV origin of replication (Epicenter Biotechnologies) pCDF-1b Smr Spr Replicon from CloDF13 for protein expression (Novagen) pACYC184 Cmr Tcr Cloning vector (10) pCWR1324 pCC1(blunt) PCR product containing the integrase gene from Tn916 pCWR1122 pCC1(blunt) PCR product containing the integrase gene from Tn5386 pCWR1121 pCDF-1b Inducible expression of Tn5386 integrase pCWR1323 pCDF-1b Inducible expression of Tn5386 integrase and excisase pCWR1326 pCDF-1b Inducible expression of Tn916 integrase pCWR1327 pCDF-1b Inducible expression of Tn916 integrase and excisase pCWR1109 pACYC184 bp 1 end and integrase end of Tn5386 pCWR1110 pACYC184 bp 1 end and integrase end of Tn916 pCWR1176 pACYC184 bp 1 end and integrase end of Tn5382 pCWR1126 pACYC184 bp 1 end of Tn916 and integrase end of Tn5386 pCWR1127 pACYC184 bp 1 end of Tn5386 and integrase end of Tn916 ↵a Apr, ampicillin resistance; Cmr, chloramphenicol resistance; Eryr, erythromycin resistance; Kmr, kanamycin resistance; Smr, streptomycin resistance; Spr, spectinomycin resistance; Tcr, tetracycline resistance. Cloning vectors are specified for plasmids.
- TABLE 2.
Primers used to generate PCR products for use in excision experiments
Primer Sequence (5′-3′) Purpose Tn5382int CCTAGAAGTCGACGGTTAGCCAATGCGGGAATGAAC Tn5382 integrase end and downstream flanking region Tn5382int flank CCTAGTCGGATCCGTTCATTGATGGTCGGTGC PCR product Tn5382 bp1 CCTAGAAGTCGACGGTATTAGCAGTATGGTTCAGC Tn5382 upstream flanking region and bp 1 region PCR Tn5382bp1 flank CCTAGTCAAGCTTGTGGCGTTATCGTCACAGTC product Tn916int CCTAGAAGTCGACGTCTTGTTGCTTAGTAGTAC Tn916 integrase end and downstream flanking region Tn916int flank CCTAGTCGGATCCTATGGGAGATGATACTGTGGTCAC PCR product Tn916 bp1 CCTAGAAGTCGACTTCACTTTTCAAGGATAAATCG Tn916 upstream flanking region and bp 1 region PCR Tn916 bp1 flank CCTAGTCAAGCTTGTTGGATGTCAATTGATAGTACTAG product Tn5386int CCTAGAAGTCGACGCTCACGGCTCATTTGGTTCTGC Tn5386 integrase end and downstream flanking region Tn5386int flank CCTAGTCGGATCCTGTACCGACGATTACTACTTTACGAC PCR product Tn5386 bp1 CCTAGAAGTCGACTGATGTGCTGTATTCATAAC Tn5386 upstream flanking region and bp 1 region PCR Tn5386 bp1 flank CCTAGTCAAGCTTTTAGGTGCGATTGCTGTC product Upstream intTn5386 CCAAGTCTAGCCATGGAATATTTATATGACGTATCTAGGCTTGC Primer for amplifying the Tn5386 int gene; used with StopintTn5386 Stop intTn5386 CCAAGTCTATGGATCCGTATTTACTACAACGCACATATCC Primer for amplifying the Tn5386 int gene; used with UpstreamintTn5386 Upstream intTn916 CCAAGTCTAGCCATGGTTATAGATACATTGGACGCAATCTAG Primer for amplifying the Tn916 int gene; used with StopintTn916 Stop intTn916 CCAAGTCTATGGATCCATTTGTACTACTAAGCAACAAGACGCTCCTG Primer for amplifying the Tn916 int gene; used with UpstreamintTn916 Tn5386Xis up CAAGTCTAGCCATGGTTCTGCCCACAAGAATGG Primer for amplifying the Tn5386 xis and int genes; used with StopintTn5386 Tn916Xis up CCAAGTCTAGCCATGGTGGAACTCCCGTGAGCTTTG Primer for amplifying the Tn916 xis and int genes; used with StopintTn916 Tn5382-1 TACCGACATTCAAGAACTTCTAAAAAGATAATC Used to detect circularization of Tn5382 construct Tn5382-2 TTGGTAGTAAATTGAGTTCTCATATCCTGC Used to detect circularization of Tn5382 construct Tn916-1 GTTTTGACCTTGATAAAGTGTGATAAGTCC Used to detect circularization of Tn916 construct Tn916-17890 CACTTCTGACAGCTAAGACATGAG Used to detect circularization of Tn916 construct Tn5386-1 TGAACCCTTATAAAAGCGAATACAGCTAGG Used to detect circularization of Tn5386 construct Tn5386-2 GCTAAACTGACATTTAAGAAGTTATGAAGAGATAAGTGG Used to detect circularization of Tn5386 construct pACYC Cm-1 GATTGGCTGAGACGAAAAACATATTCTC Used for quantitative PCR to equalize plasmid quantities in plasmid preparations for excision amplifications pACYC Cm-2 TATGGGATAGTGTTCACCCTTGTTACAC Used for quantitative PCR to equalize plasmid quantities in plasmid preparations for excision amplifications
