Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Bacteriology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
MOLECULAR BIOLOGY OF PATHOGENS

The Quorum-Sensing Molecule Autoinducer 2 Regulates Motility and Flagellar Morphogenesis in Helicobacter pylori

Bethany A. Rader, Shawn R. Campagna, Martin F. Semmelhack, Bonnie L. Bassler, Karen Guillemin
Bethany A. Rader
1Institute of Molecular Biology, University of Oregon, Eugene, Oregon 97403
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shawn R. Campagna
2Department of Chemistry
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Martin F. Semmelhack
2Department of Chemistry
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Bonnie L. Bassler
3Howard Hughes Medical Institute and Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Karen Guillemin
1Institute of Molecular Biology, University of Oregon, Eugene, Oregon 97403
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: guillemin@molbio.uoregon.edu
DOI: 10.1128/JB.00246-07
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    AI-2 production in H. pylori is luxS dependent. AI-2 production in the wild-type strain G27 (A), the ΔluxS mutant (B), and the complemented luxS* strain (C) was measured as the ability of CFS harvested at the indicated times after inoculation of liquid H. pylori cultures to induce bioluminescence in the V. harveyi reporter strain BB170 (relative light units [RLU]; bars). The cell densities of the cultures across the growth curves were determined by viable plate counts (CFU/ml; diamonds). Error bars indicate standard deviations of triplicate or duplicate samples for the bioluminescence and cell density measurements, respectively.

  • FIG. 2.
    • Open in new tab
    • Download powerpoint
    FIG. 2.

    The ΔluxS mutant has a motility defect that is rescued by wild-type CFS. Wild-type, ΔluxS, and luxS* bacteria were seeded onto soft agar plates composed of normal medium or supplemented with CFS from wild-type or ΔluxS cultures. After 6 days of incubation, the halos of migration were visualized (A) and quantified (B). Error bars indicate the standard deviation of halo sizes of triplicate cultures in one experiment.

  • FIG. 3.
    • Open in new tab
    • Download powerpoint
    FIG. 3.

    AI-2 modulates flagellar morphogenesis. Representative flagella, as visualized by TEM, are shown for each of the genotypes indicated grown in normal medium (A to C, E, F, I, J, M, and N) or for 4 h in the presence of 0.1 mM DPD (G, K, and O). In all cells with flagella, the base is marked by an arrow, and the tip is marked by an arrowhead. Scale bars, 1 μm. The flagellar morphologies were scored for at least 100 cells for each treatment group (D, H, L, and P).

  • FIG. 4.
    • Open in new tab
    • Download powerpoint
    FIG. 4.

    AI-2 modulates flagellar gene transcription. Transcript levels of flgS, fliA, flgM, and flaA (A) and of flhA (B) were determined by qRT-PCR normalized to the levels of ureA in each of the genotypes indicated and are represented as the log2 difference relative to the levels in the wild-type strain. Levels of the same transcripts were determined in the indicated genotypes and normalized to the levels of the 16S rRNA gene in each sample (C). AI-2 activity in CFS from wild-type early-stationary-phase H. pylori was measured relative to different concentrations of DPD (D). flhA transcript levels were measured as in panel B in wild-type and ΔluxS cultures untreated or treated for 4 h with 0.1 mM DPD (E) and in ΔluxS cultures treated with a range of DPD concentrations (F). Error bars indicate the standard deviations for three triplicate samples.

  • FIG. 5.
    • Open in new tab
    • Download powerpoint
    FIG. 5.

    Model of AI-2 modulation of the H. pylori flagellar regulon. The role of AI-2 in transcriptional regulation of components of the flagellar gene hierarchy of H. pylori is shown, based on Neihus et al. (36). AI-2 signals upstream of FlhA, which, in turn, regulates branching pathways of gene transcription regulated by FlgS, FlgM, and FliA/σ28.

Tables

  • Figures
  • TABLE 1.

    Strains used in this study

    H. pylori strainDescriptionReference or source
    Wild typeG27 14
    luxS strain luxS::kan sacB This study
    ΔluxS strainDeletion of HP0105This study
    luxS* strain rdx::luxS and deletion of luxS This study
    fliA strain fliA::kan This study
    fliA ΔluxS strain fliA::kan and deletion of luxS This study
    flgS strain flgS::kan This study
    flgS ΔluxS strain flgS::kan and deletion of luxS This study
    flgM strain flgM::kan This study
    flgM ΔluxS strain flgM::kan and deletion of luxS This study
    flhA strain flhA::kan This study
    flhA ΔluxS strain flhA::kan and deletion of luxS This study
  • TABLE 2.

    Primers used for cloning and RT-PCR

    PrimerSequence (5′-3′)
    LuxSSpeRAAAATCATTCCCCAAACCAATGATCAGGG
    LuxSEcoFCCGGAATTCAGAGCAAGCGTTCGCTAAAA
    TopoXbaFGCTCTAGACTGAGATCATCCGCAACCAT
    TopoBlgRGAAGATCTTTGGCATGTCCATGTGATCT
    FBglIIpKan+GAAGATCTTCCCGGGCGAACCATTTGAGGTGA
    PFA3GCTCTAGACCCGGGTATAAGCCCATTTTCATGC
    FLS2BamCGGGATCCGAGGCGGTTGCTTTTGTAGA
    LuxS3ABCGACATAACTGGCATGGTTGGCGAACGCTTGCTCTAAA
    RLS2Xho2TTTATCTTCTCGAGCGCCCATGAATGTCTGAAGT
    RdxA1FTAAACGAGCGCCATTCTTG
    RdxA1LRGATTAAAAGCGCTTCAGCGTGAGGCGGTTGCTTTTGTAGA
    RdxA2LFCTTCAGACATTCATGGGCGATTCAACCACAGCATGCAAA
    RdxA2RCGATCAAGCATGCGATTTTA
    FliaAFTGCTTCGTTTCAACCATGAG
    FliaAKAAGCAACAACACCACCATCACAGGAAACAGCTATGACA
    FliaBKCTGGCCGTCGTTTTACTCGCGCATTTCTCAAATC
    FliaBRACTCACACGATTAGGGCGTTT
    HP0244AFCGATGAGATTTATGCGTCCA
    HP0244AKCCTTATTTGAAGCGTTCCCACAGGAAACAGCTATGAC
    HP0244BKACTGGCCGTCGTTTTACGAGAGCGAACAGGGTCAA
    HP0244BRGCTAACCCTAGGCCGTTACC
    FlgMAFGTTGTGGTTGCTCATGTTCG
    FlgMAKAATGCCGTTTCTTCTCTTGCAGGCAACAGCTATGA
    FlgMBKACTGGCCGTCGTTTTACTCTCACAAAATGGCAAAGGA
    FlgMBRTCCTAACTTCATGATTGA
    FlhAIntFCCTAGTGCGGTGAGCGATATTATC
    FlhAIntRGCTCACGCTAAATTCCCCAA
    UreAIntFAAAGACTGCGGCTGAATTG
    UreAIntRCCATCACATCATCCGGTTT
    FlhABgl2GAAGATCTACCTCACAAGAACCCGTATCGT
    FlhAXho2ATTCCGCTCGAGCAATGGAAACTCTCAGCCACTTC
    M13Nhe1CTAGCTAGCGTAAAACGACGGCCAGT
    M13Acs1TTGGCGCGCCCAGGAAACAGTTATGAC
    1320fCCATGAAGTCGGAATCGCTAG
    1431rACTCCCATGGTGTGACGG
PreviousNext
Back to top
Download PDF
Citation Tools
The Quorum-Sensing Molecule Autoinducer 2 Regulates Motility and Flagellar Morphogenesis in Helicobacter pylori
Bethany A. Rader, Shawn R. Campagna, Martin F. Semmelhack, Bonnie L. Bassler, Karen Guillemin
Journal of Bacteriology Aug 2007, 189 (17) 6109-6117; DOI: 10.1128/JB.00246-07

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Bacteriology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
The Quorum-Sensing Molecule Autoinducer 2 Regulates Motility and Flagellar Morphogenesis in Helicobacter pylori
(Your Name) has forwarded a page to you from Journal of Bacteriology
(Your Name) thought you would be interested in this article in Journal of Bacteriology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
The Quorum-Sensing Molecule Autoinducer 2 Regulates Motility and Flagellar Morphogenesis in Helicobacter pylori
Bethany A. Rader, Shawn R. Campagna, Martin F. Semmelhack, Bonnie L. Bassler, Karen Guillemin
Journal of Bacteriology Aug 2007, 189 (17) 6109-6117; DOI: 10.1128/JB.00246-07
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

flagella
Gene Expression Regulation, Bacterial
Helicobacter pylori
Homoserine
Locomotion
morphogenesis

Related Articles

Cited By...

About

  • About JB
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jbacteriology

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0021-9193; Online ISSN: 1098-5530