Article Figures & Data
Figures
- FIG. 1.
Construction of mutant strains. (A) Construction of the sbcD-lacZ reporter strain (DL1649). Shown is a schematic representation of the sbcDC region containing the PsbcDC-lacZ reporter fusion. Part of the sbcDC operon was removed, and the cassette containing the lacZ and the kanamycin resistance genes was placed under the control of the sbcDC promoter region and fused to the beginning of the sbcD gene. sbcD′, 3′ truncated sbcD gene; Kanr , kanamycin resistance gene; ′sbcC, 5′ truncated sbcC gene. (B) Construction of functional gfp-sbcC/D reporter strains (DL2478 and DL2479). Shown is a schematic representation of the att region containing the gfp-sbcC or gfp-sbcD reporter fusion. The gfp-sbcC/D fusion was placed under the control of the IPTG-inducible trc promoter region, and the protein fusion to the GFP was N terminal. bla, ampicillin resistance gene.
- FIG. 2.
Analyses of sbcDC transcription and SbcC protein level as a function of time and growth medium. (A) The transcriptional sbcD-lacZ gene fusion schematically shown in Fig. 1A was used to determine the time course of sbcDC expression in cells grown at 37°C in either LB (left panel) or supplemented M9 (right panel) medium. The strains used for the analyses were E. coli MG1655 Δ(Plac-lacZY) (crosses; EDCM367) and E. coli MG1655 Δ(Plac-lacZY) ΔsbcDC PsbcDC-lacZ-aph (closed squares; DL1649). Samples for the determination of β-galactosidase activities (indicated in nmol/min/OD600) were collected at defined times. Time 0 indicates the transition point between exponential and postexponential growth phases determined by a change in the slope of the growth curve. (B) GFP-SbcC fusion was used to determine by Western blotting the time course of SbcC protein levels in cells grown at 37°C in either LB or supplemented M9 medium. The position of the fusion protein is indicated. The protein marker positions were marked on the film from positions shown on the membrane. Time 0 indicates the transition point between exponential and postexponential growth phases. Times are indicated in hours. ON indicates overnight cultures. Strains used for the analyses were E. coli MG1655 Δ(Plac-lacZY) (EDCM367; −, overnight culture as negative control), E. coli MG1655 Δ(Plac-lacZY) GFP-sbcC (DL2533; GFP-sbcC), and E. coli MG1655 att::207NGFP-sbcC, grown in the presence of 50 μM of IPTG (DL2478; +, overnight culture as positive control).
- FIG. 3.
Effect of the rpoS or clpX mutation on sbcDC transcription and SbcC protein level. (A) The transcriptional sbcD-lacZ gene fusion, schematically shown in Fig. 1A, was used to determine the time course of sbcDC expression in the presence and absence of the rpoS or clpX gene in cells grown at 37°C in either LB (left panel) or supplemented M9 (right panel) medium. Strains used for the analyses were E. coli MG1655 Δ(Plac-lacZY) (crosses; EDCM367), E. coli MG1655 Δ(Plac-lacZY) ΔsbcDC PsbcDC-lacZ-aph (closed squares; DL1649), E. coli MG1655 Δ(Plac-lacZY) ΔsbcDC rpoS359::Tn10 PsbcDC-lacZ-aph (closed triangles; DL1718), and E. coli MG1655 Δ(Plac-lacZY) ΔsbcDC ΔclpX PsbcDC-lacZ-aph (closed diamonds; DL1796). Samples for the determination of β-galactosidase activities (indicated in nmol/min/OD600) were collected at defined times. Time 0 indicates the transition point between the exponential and postexponential growth phases determined by a change in the slope of the growth curve. (B) GFP-SbcC fusion was used to determine by Western blotting the time course of SbcC protein level in the presence and absence of RpoS or ClpX protein in cells grown at 37°C in either LB (top panel) or supplemented M9 (lower panel) medium. The position of the fusion protein is indicated. The protein marker positions were marked on the film from positions shown on the membrane. Time 0 indicates the transition point between the exponential and postexponential growth phases. Times are indicated in hours. ON indicates overnight cultures. The strains used for the analyses were E. coli MG1655 Δ(Plac-lacZY) (EDCM367; −, overnight culture as negative control), E. coli MG1655 Δ(Plac-lacZY) GFP-sbcC (DL2533), E. coli MG1655 Δ(Plac-lacZY) ΔclpX GFP-sbcC (DL2532), and E. coli MG1655 Δ(Plac-lacZY) rpoS359::Tn10 GFP-sbcC (DL3117).
- FIG. 4.
Localization of GFP-SbcC/D fusion proteins as a function of time and growth medium. E. coli MG1655 att::207NGFP-sbcC (DL2478; GFP-SbcC) and E. coli MG1655 att::207NGFP-sbcD (DL2479; GFP-SbcD) were grown at 37°C in either LB (left panels) or supplemented M9 (right panels) medium in the presence or absence of 50 μM of IPTG. Cells were grown either until mid-exponential growth phase or until stationary phase (overnight) and then visualized on a 1% agarose-coated slide by fluorescence microscopy using a GFP filter. The calibration bar indicates 2 μm.
- FIG. 5.
Colocalization of GFP-SbcC and RFP-SeqA fusion proteins. E. coli BW27784 att::207NGFP-sbcC carrying the pseqAredKm plasmid (DL2739 plus pseqAredKm) was grown at 37°C in supplemented M9 medium in the presence of 50 μM of IPTG and 0.001% of arabinose until mid-exponential growth phase. Cells were visualized on a 1% agarose-coated slide by fluorescence microscopy using a DAPI/FITC/TRITC filter set.
Tables
- TABLE 1.
Plasmids, bacterial strains, and primers
Plasmid, strain, or primer Relevant propertiesb Reference or source Plasmids p18seqA pLAU18 derivative plasmid carrying a SeqA-eYFP C-terminal fusion under the control of an arabinose-inducible promoter (PBAD); Ampr This work p207NsbcC pDSW207 derivative carrying a GFP-SbcC N-terminal protein fusion; Ampr This work p207NsbcD pDSW207 derivative carrying a GFP-SbcD N-terminal protein fusion; Ampr This work pDSW207 pTrc99A derivative containing a gfp-MCS region controlled by a downregulated trc promoter (mutation in −35 box); Ampr 30 pLAU18 pUC18 derivative permitting the construction of eYFP fusion proteins under the control of an arabinose-inducible promoter (PBAD); carries the araC gene; Ampr 13 pRSETBDsRed pRSETB derivative carrying the gene encoding the DsRed protein; Ampr 5 pseqAred p18seqA derivative vector carrying the dsRed gene in place of eyfp; Ampr This work pseqAredKm pseqAred derivative vector, where the bla gene is disrupted by the aph gene; Kmr This work pTOF24 pSC101-based vector; repA(Ts) with a sacB gene conferring sucrose sensitivity and aph from pUC4K; Cmr, Kmr, Ts, Sucs 18 pTOF30 Plasmid containing an FLK2 cassette (lacZ aph); Ampr, Kmr 18 pTOF24ΔclpX pTOF24 derivative containing two fused PCR fragments corresponding to the beginning and the end of clpX, in place of the aph gene; Cmr, Ts, Sucs This work pTOFNGFPsbcC pTOF24 derivative containing a GFP-SbcC N-terminal protein fusion and the ′sbcD sequence, permitting its integration at the locus in the E. coli chromosome; Cmr, Ts, Sucs This work pTOFNGFPsbcD pTOF24 derivative containing a GFP-SbcD N-terminal protein fusion, P sbcDC , and part of the phoB gene sequence, permitting its integration at the locus in the E. coli chromosome; Cmr, Ts, Sucs This work pTOFsbcDC pTOF24 derivative containing two fused PCR fragments corresponding to the beginning of the sbcD and the end of the sbcC genes, in place of the aph gene; Cmr, Ts, Sucs This work pTOFsbcDCK2 pTOFsbcDC derivative containing an FLK2 cassette from pTOF30; Cmr, Kmr, Ts, Sucs This work E. coli strains BW27784 lacIq rrnB3ΔlacZ4787 hsdR514 DE(araBAD)567 DE(rhaBAD)568 DE(araFGH) Φ(ΔaraEp P CP18 -araE) 11 DL1649 MG1655 Δ(P lac -lacZY) ΔsbcDC P sbcDC -lacZ-aph This work DL1718 MG1655 Δ(P lac -lacZY) ΔsbcDC rpoS359::Tn10 P sbcDC -lacZ-aph This work DL1796 MG1655 Δ(P lac -lacZY) ΔsbcDC ΔclpX P sbcDC -lacZ-aph This work DL1913 MG1655 Δ(P lac -lacZY) ΔclpX This work DL2478 MG1655 att::207NGFP-sbcC This work DL2479 MG1655 att::207NGFP-sbcD This work DL2532 MG1655 Δ(P lac -lacZY) ΔclpX GFP-sbcC This work DL2533 MG1655 Δ(P lac -lacZY) GFP-sbcC This work DL2535 MG1655 Δ(P lac -lacZY) GFP-sbcD This work DL2739 BW27784 att::207NGFP-sbcC This work DL3117 MG1655 Δ(P lac -lacZY) rpoS359::Tn10 GFP-sbcC This work EDCM367 MG1655 Δ(P lac -lacZY) 18 MG1655 F− λ− ilvG rfb-50 rph-1 2 RH90 MC4100 rpoS359::Tn10 12 Primersa clpXflank F1 AAAAA GTCGAC GCAGGGGCAAAAGGTAAAC This work clpXflank F2 GGCTCAGGCAAATGGAAGACGTCGAAAAAGTGG This work clpXflank R1 CGACGTCTTCCATTTGCCTGAGCCATCTTT This work clpXflank R2 AAAAACTGCAGCGCTTCCAGACAACGGATAG This work dsRED-XhoI AAAAA CTCGAG TTGGCCTCCTCCGAGGACGTCATCAAG This work dsRED-HindIII AAAAA AAGCTT TTAGGCGCCGGTGGAGTGG This work Km-ScaI-F AAAAA AGTACT CCACGTTGTGTCTCAAAATC This work Km-ScaI-R AAAAAAGTACTCCGTCAAGTCAGCGTAATG This work lacZ-chi-seq-R TTT TTA TCG CCA ATC CAC ATC This work NtermGFP-SbcC1 AAAAA CAATTG AACAACAACATGAAAATTCTCAGCCTGCG This work NtermGFP-SbcC2 AAAAA AAGCTT TTATTTCACTGCAAACGTAC This work NtermGFP-sbcC5 AAAAACTCGAGCCCCATTCCACTGAGTTTTG This work NtermGFP-sbcC6 TTCTCCTTTACT CAT GCTTCGTGTTCTCCGGC This work NtermGFP-sbcC7 ACACGAAGC ATG AGTAAAGGAGAAGAAC This work NtermGFP-sbcC8 AAAAA GTCGAC CTTTGTCGGCGAGAATTTTG This work NtermGFP-SbcD1 AAAAAGAATTCAACAACAACATGCGCATCCTTCACACCTC This work NtermGFP-SbcD2 AAAAAAAGCTTTCATGCTTCGTGTTCTCCGG This work NtermGFP-SbcD6 TTCTCCTTTACT CAT AACGGTTCCCTGGCG This work NtermGFP-SbcD7 GGAACCGTT ATG AGTAAAGGAGAAGAAC This work SeqA_F TTTCCATGGATGAAAACGATTGAA This work SeqA_R TTTCTCGAGGATAGTTCCGCAAAC This work sbcC1-4 AAAAA GTCGAC GTGAGTAGCGGCTGGAAAAG This work sbcDC2-1 AAAAA CTGCAG GGCCAGGGTTCATTCAGTT This work sbcDC2-2 CACACCGAGCGGCCGCAGCAGCCAGTCAAGAAAAGC This work sbcDC2-3 TGGCTGCTGCGGCCGCTCGGTGTGATTAGCCACGTA This work sbcDCnd4-4 AAAAA GTCGAC CGCCTGGCTGGTAATAATG This work ↵ a Primers are shown in a 5′-3′ direction.
↵ b Abbreviations: Cmr, chloramphenicol resistant; Kmr, kanamycin resistant; Ts, replication of the plasmid is temperature sensitive; Sucs, sucrose sensitive. Restriction sites used for cloning are underlined, ATG start codons are double underlined, and sequences used for PCR-mediated coupling are indicated in bold type.
