Article Figures & Data
Figures
- FIG. 1.
Regulation of the N. meningitidis rpsE, rpmD, rplO, and secY genes under iron-depleted and iron-replete conditions. (A) Schematic representation of the N. meningitidis MC58 secY gene and genes encoding ribosomal proteins within the spc operon. ORFs within the spc operon are labeled and encode genes for 10 ribosomal proteins [RplN (L14), RplX (L24), RplE (L5), RpsN (S14), RpsH (S8), RplF (L6), RplR (L18), RpsE (S5), RpmD (L30), and RplO (L15)], SecY, and a translation initiation factor (IF-1). The promoter region of the operon is represented as “P,” and the direction of transcription is represented with an arrow, as previously described for the E. coli spc operon (3). The ORFs represented are not drawn to scale. (B) Schematic representation of the DNA fragments amplified during transcription and cotranscription analysis. Each ORF examined in this study is labeled with the corresponding gene; regions amplified are represented with double-headed arrows, and the size of each amplicon is given for each arrow. A previously identified Fur binding sequence in the upstream region of the secY gene (17) is represented by double asterisks (**). (C and D) Transcription (C) and cotranscription (D) analyses of the rpsE, rpmD, rplO, and secY genes. Cultures of N. meningitidis were grown in CDM broth under iron-depleted (−) (12.5 μM desferal) or iron-replete (+) (100 μM ferric nitrate) conditions, and samples were removed at 4 h for RNA preparation. Approximately 250 ng of total RNA was used in each in RT-PCR and was amplified with the primers listed in Table 1.
- FIG. 2.
Expression of the N. meningitidis SecY protein in response to growth under iron-depleted and -replete conditions. (A) Western blot analysis. Approximately 1.5 mg of total cell lysate was prepared from N. meningitidis MC58 grown in CDM broth under iron-depleted (−) and -replete (+) conditions and loaded onto sodium dodecyl sulfate-polyacrylamide gels. Proteins were transferred to membranes and probed with either E. coli SecY antiserum or N. meningitidis porin B antiserum (positive control for protein loading). Lanes 1 and 2, 3 and 4, 5 and 6, and 7 and 8 are samples obtained at 3, 4, 5, and 6 h, respectively. (B) Quantitative analysis. Densities of the immunoreactive bands were quantitated with the Bio-Rad Quantity One program (P < 0.001). Samples were obtained from cultures grown under iron-depleted (gray bars) and iron-replete (black bars) growth conditions. The results are representative of three independent experiments.
- FIG. 3.
Expression of the N. meningitidis secY and nspA genes in response to iron and Fur. Transcriptional analysis of the secY and nspA genes from RNA isolated from N. meningitidis MC58 (lanes 1 and 2), N. meningitidis Fko′ (lanes 3 and 4), and N. meningitidis Fko′-C (lanes 5 and 6) by RT-PCR is shown. Meningococcal rmp, fur, and aniA genes were utilized as controls. Lanes 1, 3, and 5 correspond to samples obtained from cultures grown under iron-replete conditions, and lanes 2, 4, and 6 correspond to samples obtained from cultures grown under iron-depleted conditions. The time at which samples were examined is indicated below each panel.
- FIG. 4.
EMSA analysis of meningococcal Fur binding to meningococcal secY and nspA operator DNA probes. DNA probes used are as follows: A, secY; B and C, nspA; D, rmp. One nanogram of 32P-labeled DNA fragments was incubated with increasing concentrations of N. meningitidis Fur protein. (A) Lane 1, no Fur; lanes 2 to 10, 80 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 240 nM, 300 nM, and 400 nM Fur, respectively. (B and D) Lane 1, no Fur; lanes 2 to 8, 160 nM, 320 nM, 400 nM, 480 nM, 560 nM, 720 nM, and 800 nM Fur, respectively. (C) EMSA analysis of 32P-labeled nspA DNA after incubation with meningococcal Fur and an excess of cold probe (unlabeled operator DNA fragments). Lane 1, no Fur and no cold probe; lane 2, 800 nM Fur and no cold probe; lanes 3 to 7 800 nM Fur and 50-fold, 100-fold, 200-fold, 300-fold, and 400-fold cold probe, respectively.
- FIG. 5.
DNase I footprinting analysis of N. meningitidis Fur with the nspA operator probe. (A) Footprinting analysis. The plus strand of the nspA promoter fragment was labeled and incubated with increasing concentrations of N. meningitidis Fur prior to digestion with DNase I. Lane 1, no Fur; lane 2, 150 nM Fur; lane 3, 460 nM Fur; lane 4, 1.22 μM Fur. DNA standards (GATC) are shown on the right. The region protected by Fur is indicated by the dark line. (B) Schematic representation of the operator elements of the iron-activated nspA, aniA, and secY genes and the iron-repressed fur gene. DNA sequences of the iron-activated and Fur-regulated nspA and aniA genes, the iron-repressed and Fur-regulated fur gene, and the iron-activated secY gene operators were amplified for in vitro binding studies using the primers listed in Table 1. Boxed nucleotides represent the in silico-identified Fur box. The previously reported hexameric repeat 5′-NATW(A/T)AT-3′ (17) is represented in boldface type. In the case of the nspA gene, the extent of the footprinted region is represented by a double-headed arrow.
Tables
- TABLE 1.
Primers used in this study
Primera Sequence (5′→3′)b Description F1 GAATACAATTCAACCTGCT Amplifies 435-bp meningococcal rp1O ORF R1 ATTTCAATCTTACCACCAA F2 GTTAAAAGCCTGATTGGTA Amplifies 186-bp meningococcal rpmD ORF R2 AAGACTCCACTTTCAACAA F3 GTTAACTCCCAAAATGTCTT Amplifies 519-bp meningococcal rpsE ORF R3 CAAAACATGAAATTGAAGAA F4 CGGGATCCCGTACAGCTCGCTTCTGAAAT Amplifies 613-bp fragment of the meningococcal secY ORF R4 CCAAGCTTGGCTATTTGTATCAGCCGAACC F5 GAAGATTTTGGATTTGTTCG Amplifies 339-bp fragment of the meningococcal fur ORF R5 CACACGCCGTACATATAAAG F6 TCAAGCTCTTTAGGTTCTGC Amplifies 347-bp fragment of the meningococcal nspA ORF R6 ATGTAGTTGTAGCGGTAGCC F7 ATACGGTTGAAGTGGAAT Amplifies 520-bp fragment of the meningococcal aniA ORF R7 AACATAAACTTTGTCGAAGA F8 CG GGATCC CGCAAGGTTTCATTTAATAAG Amplifies 111-bp promoter fragment of the meningococcal secY/ribosomal operon R8 CG GGATCC CGATCTAAGATGGTCTGCATTT F9 GC TCTAGA GCAAAATATTGCGATGCAAAA Amplifies 101-bp promoter fragment of the meningococcal nspA gene R9 CG GGATCC CGATATTTTGGTTCCTTTATGG F10 CG GGATCC CGCTGCTTCTTTATAGTGGAGA Amplifies 114-bp promoter fragment of the meningococcal rmp gene R10 CG GGATCC CGCCTCATTAAATTTGTACAGC
- Top
- Article
- ABSTRACT
- Regulation of the N. meningitidis secY and ribosomal protein genes in response to iron.
- Role of Fur in the regulation of the N. meningitidis secY and nspA genes.
- Binding studies of meningococcal Fur to operator sequences of the iron-activated nspA and secY genes.
- Mapping of Fur binding sequences in the promoter/operator of the iron-activated nspA gene.
- Conclusions.
- ACKNOWLEDGMENTS
- FOOTNOTES
- REFERENCES
- Figures & Data
- Info & Metrics