Article Figures & Data
Figures
- FIG. 1.
Gliding behavior and fruiting-body development of the M. fulvus wild-type strain HW-1 (B, D, F, and H) and its mutant HL-1 (A, C, E, and G). Colony expansions were done on CTT medium with 1.5% (A and B) or 0.3% (C and D) agar for 3 days. Colony edge morphologies were done on CTT hard (1.5%) agar (E and F). Development of fruiting bodies was carried out on TPM plates (G and H) for 5 days, with inoculation of 5 × 109 cells/ml. The plates were incubated at 30°C. Bars, 0.6 cm for panels A to D, 30 μm for panels E and F, and 1.5 mm for panels G and H.
- FIG. 2.
Swarming colony sizes of the mutant HL-1 and the wild-type strain HW-1 on the nutrient medium CTT without (dashed lines) or with (solid lines) 20% seawater and with different concentrations of agar.
- FIG. 3.
Physical organization of the mts region (13.0 kb) on the M. fulvus chromosome and the MiniHimar1-lacZ insertion site (indicated by an open arrowhead). The ORFs and predicted transcription directions are represented by arrows. The locations of the restriction enzyme sites used for the cloning sequence are shown. S, SphI; B, BamHI.
- FIG. 4.
Morphological characteristics of the wild-type strain M. xanthus DK1622 and its mutants ZC16-4 (ΔMXAN1334) and ZC16-23 (deletion of MXAN1332 to MXAN1337); the A− S+ strain M. xanthus DK1217 and its mutant ZC12-3 (ΔMXAN1334); and the A+ S− strain M. xanthus DK10410 and its mutant ZC10-1 (ΔMXAN1334). Colony expansions were done on CTT medium with 1.5% (A to E, N, and O) (bar, 1.0 cm) and 0.3% (F to J, P, and Q) (bar, 0.7 cm) agar for 5 days. Development of fruiting bodies was done on TPM plates (K to M) (bar, 1.5 cm) for 5 days. The plates were incubated at 30°C. (R to T) Cell movement at the swarming edges of DK1622, ZC16-4, and ZC16-23 on 1.5% agar. Bar, 50 μm.
Tables
- TABLE 1.
Myxobacterial strains and plasmids
Strain or plasmid Relevant characteristic Reference or sourcea Strains M. fulvus HW-1 (ATCC BAA-855) Wild type 17 HL-1 mtsC::MiniHimar1-lacZ This study M. xanthus DK1622 Wild type 13; D. Kaiser, Stanford University DK1217 aglB1 8; Z. M. Yang, Virginia Tech DK10410 ΔpilA 25; M. H. Singer, University of California, Davis ZC16-4 ΔMXAN1334 This study ZC12-3 aglB1 ΔMXAN1334 This study ZC10-1 ΔpilA ΔMXAN1334 This study ZC16-23 Deletion of MXAN1332 to MXAN1337 This study Plasmids pMiniHimar1-lacZ Kmr lacZ H. B. Kaplan, University of Texas pBJ113 Gene replacement vector with KG cassette; Kmr 12; Z. M. Yang, Virginia Tech pZCY6 MXAN1334 in-frame deletion in pBJ113 This study pZCY9 MXAN1332 to MXAN1337 deletion in pBJ113 This study ↵ a Virginia Tech, Virginia Polytechnic Institute and State University.
- TABLE 2.
Primers used for TAIL-PCR amplificationa
Primer Length (bp) Sequence (5′ to 3′) Tm (°C) Specific primers 1332-LTL1 25 TCCGGCTGATAGCGATGCGCCACCC 70.2 1332-LTL2 25 GCATCCACCACCGTCAAGGGAAGTC 66.9 1332-LTL3 25 CGGCTGGGATGTTTCATTGCTCTTG 63.6 TL-1 25 CAGCGGGCAGTTGTCTACATCGTTG 65.3 TL-2 21 TTGGAGACGAA GGGGCAGTTG 61.9 TL-3 23 TGTCGCCGTCGTCCGTGTAGTTC 65.5 AD primers AD4 16 TG(A/T)GNAG(A/T)ANCA(G/C)AGA 43.9 AD7 16 CA(A/T)CGICNGAIA(G/C)GAA 43.0 ↵ a TAIL-PCR, thermal asymmetric interlaced PCR; Tm , melting temperature.
