The Gene Cluster for Agmatine Catabolism of Enterococcus faecalis: Study of Recombinant Putrescine Transcarbamylase and Agmatine Deiminase and a Snapshot of Agmatine Deiminase Catalyzing Its Reaction

Bacterial growth and characteristics. E. faecalis SD10 was grown overnight at 37°C, without shaking, in medium A (49) supplemented with 25 mM glucose. This strain is highly similar to E. faecalis V583 as judged from previous studies on the ADI operon (3) and also from the comparison of the sequences determined here for genes ef0732 and ef0734, which have revealed, of a total of 2,130 bases, only nine base differences relative to the corresponding sequence of the E. faecalis V583 genome, with only one of them causing an amino acid change (ef0734, H325R). Genomic DNA was isolated according to a standard procedure for bacteria (57).

Cloning and expression in E. coli of ef0732 and ef0734.ef0732 and ef0734 were PCR amplified from genomic DNA from E. faecalis SD10 by utilizing a high-fidelity thermostable DNA polymerase (Deep Vent; New England Biolabs) and the primer pairs 5′⁶⁸⁹⁵¹²AGGAGGAACAC CAT ATGAAAAGAGATTAC⁶⁸⁹⁵⁴⁰and 5′⁶⁹⁰⁵⁶⁵AATCAGTGGA AGCTTGGCCGTTAAATGC ⁶⁹⁰⁵³⁸(for ef0732) and 5′⁶⁹¹⁹⁶⁹GAACGAAAG C A T ATGGCTAAACGAATTG ⁶⁹¹⁹⁹⁶and 5′⁶⁹³¹⁰⁶ATCACTATTTTTGA AT TCTGTTTCCCTCC ⁶⁹³⁰⁷⁸(for ef0734), where the first primer in each pair corresponds to the coding strand and the second to the complementary strand, the superscript numbers are the coordinates in the TIGR database for the E. faecalis genome, underlining indicates mutated bases, and boldface identifies nucleotides belonging to the open reading frame to be amplified. These primers were designed to introduce an NdeI site at the initiator ATG codon and HindIII and EcoRI sites 6 or 11 nucleotides downstream of the stop codon of ef0732 or ef0734, respectively. The PCR products, digested with NdeI-HindIII or NdeI-EcoRI, were inserted directionally in the corresponding sites of plasmid pET-22b behind the promoter recognized by T7 DNA polymerase. The resulting plasmids, isolated from transformed E. coli DH5α cells grown in Luria-Bertani (LB) medium containing 0.1 mg ml⁻¹ of ampicillin, were mutated at the translation termination codon by using the QuikChange site-directed mutagenesis kit (from Stratagene) and the oligonucleotide pair 5′CAAAGCATTTCAGCGGCCAAGCTTG3′ and 5′CTTGGCCGCTGAAATGCTTTGAGTG3′ for ef0732, to replace the translation termination codon by serine and to introduce an extra G after this mutated codon, and the pair 5′GAACCAAAGCGCGTAGGAGGGAAACAGAATTCG3′and 5′CTGTTTCCCTCCTACGCGCTTTGGTTCTTGTTG3′for ef0734, to introduce a G before the translation termination codon. These mutations abolish termination at the normal stop codon and place in frame the plasmid sequence for incorporating at the cloned protein C terminus a linker and a His₆ sequence. In this way, the ef0732 and ef0734 gene products include, respectively, the 16- and 24-amino acid C-terminal extensions SAAKLAAALEH₆ and VGGKQNSSSVDKLAAALEH₆. The mutant plasmids, isolated from transformed DH5α cells and confirmed by sequencing to carry the correct constructions, were used to transform E. coli BL21(DE3) cells. After growth of the cells at 37°C (ef0732) or 30°C (ef0734) in liquid LB medium supplemented with 0.1 mg ml⁻¹ of ampicillin until a turbidity at 600 nm of 0.6 to 0.7 was attained, 0.1 mM isopropylβ -d-thiogalactopyranoside (IPTG) was added, and the culture was continued for 3 to 4.5 additional hours before the cells were harvested by centrifugation. All subsequent purification steps were carried out at 0 to 4°C.

Purification of the product of the cloned ef0732 gene.The cells were suspended in 1/100 of the original culture volume of 20 mM K-phosphate, pH 7.4, containing 10 mM putrescine and 20 mM imidazole; they were then broken by sonication (four pulses of 30 s each; MSE Soniprep 150 fitted with the standard probe), and the sonicate was centrifuged at 15,800 × g for 10 min. The supernatant was loaded onto a 5-ml His-trap Ni affinity column (Amersham Biosciences) mounted on an ÁKTA fast protein liquid chromatography (FPLC) system (Amersham Biosciences), equilibrated, and run at 1 ml min⁻¹ with 50 mM K-phosphate, pH 7.0, containing 20 mM imidazole. The column was washed with the same buffer until the optical absorption of the effluent returned to baseline, and then a 100-ml linear gradient of 20 to 500 mM imidazole in 50 mM K-phosphate, pH 7, was applied and 3-ml fractions were collected. Fractions containing the essentially pure protein (monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE] and Coomassie blue staining) were pooled and concentrated to∼ 20 mg ml⁻¹ by centrifugal ultrafiltration (Amicon Ultra 30K device from Millipore), 20% (vol/vol) glycerol was added, and the protein was stored at− 20°C.

Purification of the product of the cloned ef0734 gene.The purification of the product of the cloned ef0734 gene was as for the product of the ef0732 gene except for (i) the utilization as cell suspension buffer of 50 mM K-phosphate, pH 7, containing 1 mM dithiothreitol (DTT) and 0.5 mM phenylmethylsulfonyl fluoride; (ii) the inclusion of 1 mM DTT in all the solutions; (iii) the use with the His-trap step of a 25-ml gradient; and (iv) the incorporation of two additional purification steps as follows. The fractions (2 ml each) of the first His-trap column step containing the purer protein (by SDS-PAGE monitoring) were pooled, concentrated, and placed in 50 mM K-phosphate (pH 7.0)-1 mM DTT-0.5 M NaCl by repeated centrifugal ultrafiltration and then were subjected to repurification through the 5-ml His-trap column as in the first step, except for the inclusion in all the solutions of 0.5 M NaCl. The fractions containing the purer protein were concentrated again, freed from imidazole by centrifugal ultrafiltration, and subjected to size exclusion chromatography (∼10 mg per injection to the column) on a Superdex 200HR 10/30 column (Amersham Biosciences) mounted on an ÁKTA FPLC system equilibrated and run at 0.25 ml min⁻¹, using a solution of 50 mM K-phosphate (pH 7.0), 1 mM DTT, and 0.5 M NaCl. The fractions containing the essentially pure protein were pooled, concentrated to ∼20 mg ml⁻¹, and placed in 50 mM Tris-HCl (pH 7.4)-0.5 M NaCl-1 mM DTT by centrifugal ultrafiltration and were then supplemented with 10% (vol/vol) glycerol and stored at− 20°C.

Enzyme activity assays.AgDI and PTC activities were assayed at 37°C by the production of carbamoyl putrescine, determined colorimetrically at 465 nm in an assay for ureido groups (40) based on the Archibald procedure (1). The color yield of carbamoyl putrescine in this color reaction (24,320 M⁻¹ cm⁻¹) was estimated after complete conversion of agmatine to carbamoyl putrescine by using a large excess of AgDI and was found to be 25% higher than the color yield of citrulline. The AgDI assay mixture (33) contained 50 mM EDTA brought to pH 7.8 with NaOH, 1 mg ml⁻¹ bovine serum albumin (at the high dilutions used, the enzyme was unstable unless 1 mg ml⁻¹ bovine serum albumin was added), and 5 mM agmatine (unless varied) or the compounds tested to replace agmatine (l-arginine, l-argininamide, or arcaine). The PTC assay mixture contained 50 mM Tris-HCl (pH 7), 0.1 mg ml⁻¹ bovine serum albumin, and 10 mM of both carbamoyl phosphate and putrescine (unless otherwise indicated). When varying the concentration of one substrate, the other was fixed at 10 mM. In both assays the amount of the enzyme was adjusted to ensure that there was no consumption of >20% of any substrate, even at the low substrate concentrations used in the investigation of K_m values. The reactions were terminated after 5 to 15 min with 7% cold trichloroacetic acid, and the amount of carbamoyl putrescine was determined. Results at variable substrate concentrations were fitted to hyperbolae by using the program GraphPad Prism (GraphPad Software, San Diego, CA). One enzyme unit corresponds to the production of 1 μmol carbamoyl putrescine min⁻¹.

Analytical gel filtration chromatography.Analytical gel filtration chromatography was done with a Superdex 200HR (10/30) column mounted on an ÁKTA FPLC and equilibrated and eluted at 24°C, at a flow rate of 0.25 ml min⁻¹, with a solution of 50 mM Tris-HCl, pH 7.5, containing 0.15 M NaCl. The sample contained 0.1 mg of the protein of interest in 0.25 ml. Protein in the effluent was monitored by the optical absorption at 280 nm. A semilogarithmic plot of the molecular masses of marker proteins (from Amersham Biosciences or Sigma or produced in our laboratory [14, 28, 44]) versus the distribution coefficient (K_d ) for each protein was used for estimating the masses of AgDI and PTC. K_d values were calculated from the expression K_d = (V_e − V ₀)/(V_i − V ₀), where V ₀, V_i , and V_e are the elution volumes of dextran blue, water (estimated by monitoring conductivity), and the protein of interest, respectively.

Growth of protein crystals and data collection by X-ray diffraction.The sparse-matrix sampling vapor-diffusion method (22) was used for crystallization tests carried out in hanging drops in multiwell plates with commercial kits (Crystal Screen I and II from Hampton Research). The drops contained equal volumes (1 to 1.5 μl) of reservoir solution and of a 10-mg ml⁻¹ solution of PTC or AgDI, prepared by repeated centrifugal ultrafiltration of the enzyme in 50 mM Tris-HCl, pH 7.45, containing also, in the case of AgDI, 1 mM dithiothreitol and 20 mM NaCl. Crystals of the two enzymes grew in about 1 week at 21°C. The best PTC crystals were obtained in the presence of 430 μM PAPU, using a crystallization solution consisting of 125 mM (NH₄)₂SO₄, 17% polyethylene glycol 3.35K (Hampton Research), and 0.1 M bis-Tris, pH 5.5. The best AgDI crystals were obtained in the presence of 5 mM agmatine, using as reservoir fluid 0.1 M HEPES (pH 7.5), 1.5 M sodium chloride, and 1.6 M ammonium sulfate. The crystals were harvested in the corresponding crystallization solution supplemented with 15% (vol/vol) glycerol as cryoprotectant, flash-cooled in liquid nitrogen, and diffracted at 100 K (Oxford Cryo-Systems) using synchrotron radiation (ESRF, Grenoble, France; beamline ID 23-2 for PTC and BM-16 for AgDI). The PTC and AgDI data sets, collected to 3 and 1.65-Å resolutions, respectively, were processed and scaled with MOSFLM and SCALA (CCP4 suite [6]). Table 1 gives the results of the data collection as well as the spatial group and size of the cell for each of the proteins.

Phasing, model building, and refinement with the AgDI crystal data.Molecular replacement using MOLREP (55), utilizing as a model the deposited (although not yet analyzed or reported) structure at 2.9 Å of the subunit of AgDI from Streptococcus mutans (PDB accession number 2EWO), yielded a solution consisting of eight subunits in the asymmetric unit. Rigid-body and restrained refinements were performed using REFMAC (36), alternating with graphic model-building sessions with the program Coot (12). B factors and positional noncrystallographic symmetry restraints were used and gradually released as refinement progressed. TLS (58) was used in the last step of refinement.

All of the diffraction data were used throughout the refinement process, except the 5% randomly selected data for calculating R _free. Refinement converged to a final R value of 16.8% (R _free = 19.2%). The final model, at 1.65-Å resolution, consisted of the chain spanning residues 2 to 367, 2 to 364, 2 to 368, 2 to 373, 1 to 368, 2 to 368, 2 to 367, and 2 to 366 for subunits A, B, C, D, E, F, G, and H, respectively. The model includes in all of the subunits one molecule of agmatine (as an amidine derivative [see Results]) covalently bound to Cys357. The stereochemistry of the model, checked with PROCHECK (27), is reasonably good. Table 1 summarizes the data on the refinement process and on the final model.

Other methods.Protein was assayed by the method of Bradford (5), using a commercial reagent from Bio-Rad and bovine serum albumin as a standard. SDS-PAGE was carried out as described by Laemmli (26). Sequence alignments were carried out with ClustalW (53), using default values. Superposition of structures was carried out with the program SSM (25). Buried surface areas were calculated using NACCESS (http://wolf.bms.umist.ac.uk/naccess ). Figures of protein structures were generated using BOBSCRIPT (13), Raster3D (34), and Pymol (http://pymol.sourceforge.net/ ).

Materials.Purified recombinant E. faecalis ornithine transcarbamylase (3, 31) (specific activity, 4,021 U mg⁻¹) was a gift of J. Sellés, from this laboratory. PAPU was prepared and purified as previously reported (41) and had the expected contents of phosphate (determined after hot-acid digestion [4]) and free amino groups (assayed with ninhydrin [51] or by reverse-phase high-pressure liquid chromatography after ortho-phtaldialdehyde derivatization [43]; phosphoethanolamine was used as the standard). It yielded a mass (4700 Proteomic matrix-assisted laser desorption ionization-time-of-flight analyzer from Applied Biosystems; CIPF, Valencia, Spain) of 212.05 Da (expected mass of the monopositive ion, 211.2 Da). Agmatine, putrescine, cadaverine, ornithine, carbamoyl phosphate, and arcaine were from Sigma.

Atomic coordinate and structure factor accession number.The coordinates and structure factors have been deposited in the Protein Data Bank (http://www.rcsb.org/ ) with the accession code 2J2T.

Agmatine catabolism gene cluster of E. faecalis V583.The predicted genes ef0732, ef0733, ef0734, and ef0735 (Fig. 1) are on the same DNA strand of the E. faecalis V583 chromosome; separated by proposed intergenic distances of 66, 76, and 11 bp; and annotated in the current version of the TIGR database as the genes for putative ornithine transcarbamylase, an amino acid permease, a hypothetical conserved protein, and a putative carbamate kinase, respectively. By analogy with the operon for arginine catabolism, in which the genes for arginine deiminase, ornithine transcarbamylase, carbamate kinase, and the arginine/ornithine antiporter are designated arcABCD (for arginine catabolism), we here designate the ef0734, ef0732, ef0735, and ef0733 genes agcABCD (for agmatine catabolism), respectively (Fig. 1A). No open reading frames have been identified on the same DNA strand within the 1,143 bases preceding agcB or within the 197 bases following agcC. The latter 197-base region hosts a predicted good, highly stable, protein-independent transcription terminator hairpin (terminator 851 in the E. faecalis V583 genome [TransTerm v 2.0 Beta program; http://www.cbcb.umd.edu/software/TransTerm ]) that may limit the span of the transcriptional unit downstream. A less stable terminator hairpin is predicted in the 66-residue intergenic region between agcB and agcD (terminator 850 in the E. faecalis genome), thus resembling the observation for the ADI operon of an internal hairpin of suboptimal stability after the gene for ornithine transcarbamylase, which caused only partial termination (3).

The identification in the TIGR database of the first codon of the open reading gene for agcA is in error: there are two more upstream in-frame ATG codons, at 12 and 28 triplets from the proposed initiator ATG, of which the most upstream one is the genuine one because (i) it is the only one that is preceded, 12 bases upstream, by a good Shine-Dalgarno ribosomal binding sequence (AG A AGG [the base differing from the canonical sequence is underlined]); (ii) the protein expressed from this ATG is a highly active AgDI (see below); (iii) there is correspondence between these 28 N-terminal residues and the N-terminal sequence of the AgDI from P. aeruginosa (38); and (iv) in the crystal structure of E. faecalis AgDI presented here, all these residues except Met1 are well ordered and integrated into the enzyme crystal structure, as expected for a genuine portion of the natural enzyme. Therefore, this ATG is eight bases into the preceding agcD gene, and thus agcD and agcA overlap.

The product of the cloned agcB gene is genuine putrescine transcarbamylase.The amino acid sequence encoded by the first gene of the cluster, agcB (open reading frame spanning nucleotides 689526 to 690545 of the E. faecalis genome), has the same length (339 amino acids) and exhibits 31% sequence identity with the OTC encoded by the arcB gene of the ADI operon of E. faecalis (3). The identity extends to the carbamoyl phosphate and ornithine binding signature sequences ⁵²STRTR and ²⁶⁸HCLP (the amino acid numbering corresponds to the agcB-encoded protein sequence) and to 58 of the 85 residues that are totally conserved in the anabolic and catabolic OTCs of P. aeruginosa and in the arcB-encoded E. faecalis OTC (3). However, as might be expected if the product of the agcB gene were a transcarbamylase that carbamylates a substrate different from ornithine (although not much different, given the conservation of the ornithine signature), 11 of the 14 residues that are invariant in these three OTCs but that are not conserved or conservatively replaced in the agcB product map in the C-terminal half of the enzyme, corresponding to the putative ornithine domain of OTC. Further, the invariant SMG sequence of OTCs, which belongs to a mobile loop that encircles the substituents around the ornithine C^α (47), is not conserved in the putative product of agcB.

Cloning of agcB into the expression plasmid pET-22b(+) and overexpression of the gene has confirmed that the corresponding protein product is PTC. The plasmid-encoded His₆-tagged protein, overexpressed in E. coli BL21(DE3) cells (see Materials and Methods), was produced in large amounts in soluble form upon IPTG induction and was purified essentially to homogeneity (Fig. 1B), in an approximate yield of 25 mg per liter of initial culture, by a simple procedure based on the use of Ni affinity chromatography. The electrophoretic mobility of the purified protein in SDS-PAGE (Fig. 1B) corresponded to an estimated mass of 40 kDa, in agreement with the expected mass, deduced from the sequence, of 40,091 Da. Fourteen cycles of N-terminal sequencing yielded the sequence MKRDYVTTETYTKE, which includes the N-terminal Met and which corresponds to the amino acid sequence expected from the gene sequence. As previously reported for genuine E. faecalis putrescine transcarbamylase, the protein appears to be a highly stable trimer, as judged from its behavior relative to that of other proteins of known mass when subjected to chromatography in a column of Superdex 200HR (Fig. 2).

• Open in new tab
• Download powerpoint

FIG. 2.

Investigation of the oligomeric state of E. faecalis PTC and AgDI, using gel filtration. A semilogarithmic plot of molecular mass versus elution volume (expressed as K_d [see Materials and Methods]) from the Superdex 200HR column is shown. The circles correspond to the following protein standards: cytochrome c (12.3 kDa), lactalbumin (14.2 kDa), carbonic anhydrase (29.0 kDa), ovalbumin (42.7 kDa), bovine serum albumin (66.4 kDa), the dimer of bovine serum albumin (132.9 kDa), Pyrococcus furiosus carbamate kinase (68.8 kDa), intact (97.1 kDa) and truncated (31.9 kDa) aspartokinase III of E. coli, alcohol dehydrogenase (146.8 kDa), aldolase (156.8 kDa), Thermotoga maritima N-acetyl-l-glutamate kinase (182.0 kDa), amylase (223.8 kDa), catalase (230.3 kDa), ferritin (440 kDa), and thyroglobulin (669 kDa). The triangle and square denote, respectively, the positions of elution of the peaks of E. faecalis PTC and AgDI, assuming that PTC is a trimer (sequence-deduced mass, 120,273 Da) and AgDI is a tetramer (deduced mass, 165,412 Da).

Enzyme activity assays in the presence of 10 mM of both putrescine and carbamoyl phosphate proved the recombinant protein to be a highly active putrescine transcarbamylase (Fig. 1, lower part) exhibiting specific activity comparable to although somewhat higher than that of the nonrecombinant enzyme purified from E. faecalis (597 U mg⁻¹, versus 460 U mg⁻¹ for nonrecombinant PTC [56]) and yielding K_m values for carbamoyl phosphate (58± 6 μM) and putrescine (2.3 ± 0.3 mM) that also agree with prior determinations of the kinetic constants for E. faecalis PTC (56). Furthermore, also in accordance with prior results for PTC (56), the enzyme exhibits some weak activity when 10 mM putrescine is replaced by either 10 mM ornithine or cadaverine (6 and 9%, respectively, of the activity observed with putrescine).

PAPU is a very potent and highly selective inhibitor of PTC.Studies with aspartate and ornithine transcarbamylases demonstrated that phosphonoacetyl-l-aspartate (7) and phosphonoacetyl-l-ornithine (35) are, respectively, highly potent inert bisubstrate inhibitors of these enzymes. Since these inhibitors have been successfully used in crystallization trials with these two enzymes (21, 47) that led to the determination of their three-dimensional structures by X-ray diffraction, we reasoned that PAPU might be also a very potent and highly specific inhibitor of PTC and, if so, that it might help enzyme crystallization (see below). Although PAPU was synthesized previously (41), to our knowledge it has never been used with PTC. Figure 3A shows that PAPU, at micromolar concentrations, is a very potent inhibitor of PTC, causing complete inhibition. In contrast, this compound, at the same concentrations, does not inhibit E. faecalis OTC, highlighting the selectivity of this inhibitor for PTC. The inhibition is noncompetitive versus putrescine (Fig. 3B) and competitive versus carbamoyl phosphate (Fig. 3C), as expected if substrate binding in the PTC reaction is ordered, with carbamoyl phosphate binding first. From the slope of the plot of the apparent K_m for carbamoyl phosphate versus the concentration of PAPU (Fig. 3C), a K_i value of 10 nM can be estimated for PAPU. This low K_i value highlights the high affinity of the enzyme for this bisubstrate inhibitor, thus offering good opportunities for the preparation of PAPU-containing crystalline complexes of PTC that might shed structural light on substrate binding by, and specificity of, the enzyme.

• Open in new tab
• Download powerpoint

FIG. 3.

Effects of PAPU on E. faecalis PTC activity. (A) Inhibition and lack of inhibition of E. faecalis PTC and OTC, respectively, by PAPU. Activities are given as fractions of the activity in the absence of PAPU. (B and C) Influence of PAPU on the kinetic parameters of PTC for putrescine (Put) and on the K_m for carbamoyl phosphate (Carb-P_i), respectively.

The use of PAPU has allowed generation of PTC crystals suitable for X-ray analysis.To try to clarify the differences between PTC and OTC that account for the different specificities of these enzymes, we have initiated studies to determine the structure of PTC by X-ray diffraction of protein crystals. Initial crystallization trials in the absence of substrates or inhibitors, or in the presence of putrescine, yielded crystals under some conditions, and some of these crystals were of sufficient size for diffraction studies, but they diffracted X-rays poorly (more poorly than at 4-Å resolution) even when synchrotron sources were used. The addition of PAPU to the crystallization drop dramatically improved the results of the crystallization trials, strongly suggesting that these new crystals contain bound PAPU. The crystals, having a prismatic shape and a maximal dimension of ∼0.3 mm (Fig. 1D, top panel), grew in about 1 week in the presence of 0.43 mM PAPU, with (NH₄)₂SO₄ and polyethylene glycol 3.35K (from Hampton) used as crystallizing agents. The crystals diffract X-rays (ESRF synchrotron ID 23-2 source) at 3-Å resolution, allowing determination of the space group of the crystal (Table 1), which is hexagonal P6₃22, with a unit cell that would allow accommodating two or three enzyme subunits in the asymmetric unit, depending on whether 55% or 33% of the volume of the crystal is occupied by the solvent. We are presently in the process of searching for the phases by molecular replacement, using the structure of OTC from Pyrococcus furiosus (PDB file 1A1S) as the search model.

Properties of the product of the agcA gene, agmatine deiminase.Using the most upstream ATG of the open reading frame (see “Agmatine catabolism gene cluster of E. faecalis V583,” above), the coding region for the third gene of the cluster, agcA, spans nucleotides 691981 to 693078 of the E. faecalis genome. The predicted protein product has a nearly identical length (365 versus 368 amino acids) and exhibits 54% sequence identity with respect to the AgDI encoded by the aguA gene of P. aeruginosa (38). In contrast, there is no significant identity (11.6% identity, with 11 gaps) with the 408-residue sequence for the ADI of E. faecalis (3). Nevertheless, the Clustal W alignment of the AgDI and ADI sequences (not shown) aligns a cysteine residue that is near the C termini of both sequences (Cys357 of AgDI) and which is conserved in both ADIs and AgDIs and plays an analogous key catalytic role in both enzymes (see our structural data on AgDI below).

The agcA gene, cloned from the most upstream ATG codon in the expression plasmid pET-22b(+), triggered upon IPTG induction massive expression of the expected protein (Fig. 1C), in soluble form, as shown by the appearance of a large band in SDS-PAGE with a mass (46 kDa) corresponding (within experimental error) to the expected mass of the recombinant protein (43,778 Da, including an extra 2,589 Da due to the 24-residue C-terminal His₆-containing extension VGGKQNSSSVDKLAAALEH₆). The extracts of the cells expressing the protein, but not those transformed with the empty parental pET-22 plasmid, exhibited important AgDI activity (Fig. 1, bottom) whereas ADI activity in the same extracts was nil. The recombinant enzyme, purified by a combination of two Ni affinity chromatography steps and a gel filtration step, was obtained in high yield (∼40 mg per liter of initial culture) in a highly homogeneous form (Fig. 1C) and was proven by gel filtration (and also by the crystal structure [see below]) to be tetrameric (Fig. 2). This is a substantial difference with respect to the AgDIs that are involved in polyamine synthesis, which appear to be dimeric (23, 37, 59). Nevertheless, E. faecalis AgDI resembles the well-characterized polyamine-synthesizing AgDIs of corn and Arabidopsis thaliana (23, 59) in the relatively low K_m value for agmatine (35 ± 3 μM, versus 12 and 110 μM for corn and A. thaliana AgDIs, respectively) and in the similar magnitude of the activity at agmatine saturation (22.3 ± 0.4 U mg⁻¹, versus respective activities of 32 and 26 U mg⁻¹ for corn and A. thaliana). These results differ importantly from those for the only bacterial AgDI studied biochemically, the AgDI of the arginine decarboxylase (ADC) pathway of P. aeruginosa (37), for which a much larger K_m value (0.6 mM) and an∼ 4-fold-lower specific activity, relative to the E. faecalis enzyme, were reported. However, these differences may not be real, given the methodological difficulties with colorimetric activity assays at low substrate concentrations and given the instability of AgDI upon large dilution in the assay solution (which was prevented in our case by adding 1 mg ml⁻¹ bovine serum albumin). Similarly to all previous reports with AgDIs from other sources (23, 37, 60), the E. faecalis enzyme appears to be highly specific for agmatine, not using l-arginine (Fig. 1, lower panel), l-argininamide, or arcaine (1,4-diguanidinobutane). Arcaine was reported to be a competitive inhibitor (relative to agmatine) of the corn (59) and cucumber (46) enzymes, with K_i values of ∼3 and 7 μM, and we have found this compound also to be a competitive inhibitor of E. faecalis AgDI, with a K_i value of 28± 5 μM.

AgDI and ADI share the same basic fold.AgDI monocrystals of up to 1 mm in length (Fig. 1D, bottom panel) diffracted X-rays to 1.65 Å, allowing the determination of the crystal structure of the enzyme at atomic resolution. The asymmetric unit of the AgDI crystals (Table 1) contains eight subunits organized as two tetramers having identical structure. When superimposed, the root mean square deviation (RMSD) for monomers is 0.17 Å (for 364 Cα atoms). Each of the monomers has a globular fold with approximate dimensions of 53 by 45 by 40Å ³. The monomer has a tertiary fold similar to that of the catalytic domain of ADI (Fig. 4A and B), although it lacks the five-helix bundle domain of this enzyme (9). Thus, the AgDI monomer has the fan-like structure with five blades that is a distinctive trait of ADI and which results from a fivefold pseudosymmetric structure in which each repeating element consists of a three-stranded mixed β sheet and a helix in aββαβ arrangement. Given the absence in AgDI of the five-helix bundle that in ADI distorts the fan-like structure, the AgDI monomer is closer to fivefold pseudosymmetry than the catalytic domain of ADI (Fig. 4A and B). Nevertheless, the first repeat diverges from the canonical structure of the repeat, since it has two helices and the arrangement βαβαβ, and it is flanked near the fivefold pseudosymmetry axis by the C-terminal strand running antiparallel to the other three strands. The lengths and amino acid sequences, however, vary considerably from one element to another (Fig. 4E) and from those in the catalytic domain of ADI (not shown), and indeed, the superposition of AgDI with the catalytic domain of ADI (from subunit A of the Mycoplasma arginini enzyme [PDB file 1S9R]) yields a relatively large RMSD (2.77 Å for 238 Cα atoms). A distinctive characteristic of the AgDI monomer fold is the existence of large loops emerging on the side of the fan corresponding to the C end of the two parallel strands of the repeats (Fig. 4E and bottom part of Fig. 4F). Particularly large is the loop that emerges from the end of repeat 4, which includes aβ hairpin (β15 and β16). This loop folds flat over the other loops and over a protruding long α helix that emerges from repeat 1 (helix 2, Fig. 4E) in the same direction as the loops. The presence of these loops and of the protrudingα helix 2 renders highly different the two faces of the monomer that correspond to opposite edges of the repeats β sheets and also serves the purposes of forming the active center and of providing interactions with the other subunits to form the tetramer (see below). Because of the presence of these loops on one side of the subunit, and also since the α helix of each repeat fills the space between adjacent repeats diverging from the pseudosymmetry axis, the subunit has a ball-like rounded shape (see each subunit in Fig. 4F and G).

• Open in new tab
• Download powerpoint

FIG.4.

Structure of AgDI. (A and B) Ribbon representations of the monomer of E. faecalis AgDI (A) and of the catalytic domain of Mycoplasma arginini ADI (PDB entry 1S9R without residues 75 to 148, which are not a part of the catalytic domain) (B), both containing the covalently bound substrate in space-filling representation.α helices, β sheets, and loops are colored red, yellow, and green, respectively. (C) Stereo view of the active site of AgDI, showing the density map of 2F _obs − F _calc, contoured at the 0.9 σ level, around the covalent adduct. The substrate is colored yellow, and the surrounding protein residues are colored gray. O, N, and S atoms are colored red, blue, and green, respectively. (D) Interatomic distances (in angstroms) between the catalytic protein residues and the substrate around the reactive carbon center. The interactions with a fixed water molecule (W1) believed to be important in the mechanism are also represented. The density map of 2F _obs− F _calc, contoured at 0.75 σ for the covalent amidino complex, is shown. (E) Correspondence between amino acid sequence and secondary structure. Bars, arrows, and lines above the structure denote, respectively, α helices,β strands, and loops (only long loops are depicted), numbered in ascending order from N to C terminus and, when belonging to a repeat, in parentheses and having a subscript that denotes the repeat number. Open triangles under the sequence denote residues having decreased accessibility upon the binding of agmatine. Circles denote decreased accessibility upon dimer (open) and tetramer (shaded) formation. The gray sequence backgrounds highlight residues that are invariant in the AgDIs of E. faecalis, Streptococcus mutans, Pseudomonas aeruginosa, and Arabidopsis thaliana (SwissProt accession numbers Q837U5, Q8DW17, Q9I6J9, and Q8GWW7, respectively). (F) Ribbon diagram of AgDI dimer viewed perpendicularly to the molecular twofold axis. Coloring and substrate representation are as in panel A. (G) Ribbon representation of the AgDI tetramer viewed along one of the three twofold molecular axes. The two subunits of the two dimers (as defined in the text) are shown in different shades of red or blue. The covalently bound substrate is shown in space-filling representation.

The agmatine binding site explains the high specificity of AgDI for its substrate.A large mass of electron density not corresponding to the polypeptide chain and having an elongated shape was clearly visible (Fig. 4C), filling an internal cavity of the enzyme and being connected to the density of the S atom of Cys357, the cysteine residue that is close to the enzyme C terminus and that is conserved in both agmatine deiminase and arginine deiminase. The electron density at 1.65-Å resolution fits a completely extended molecule of agmatine, with its Cξ atom (the C atom of the guanidinium group of agmatine) covalently linked with the S atom of Cys357. Agmatine is bound centrally (Fig. 4A), approximately along the fivefold pseudosymmetry axis near its exit from the loop-rich side of the fan, in a closed, elongated, and crowded cavity. The central position results in the involvement in the building of the site of elements connected to all five repeats of the subunit. Thus, the site is formed between the long loop of repeat 2 and the loops that connect repeats 5 to 1, 1 to 2, and 3 to 4. The cavity is closed at its entry by a three-tongued gate formed by the loop of repeat 2 and by the long loops connecting repeats 3 to 4 and 4 to 5 (seen laterally in Fig. 4F). In our structure the closure is ensured by mutual interactions between some residues of these loops, although it is clear that these loops have to retreat at the beginning and at the end of the catalytic cycle, to allow substrate binding and carbamoyl putrescine release. The extended substrate runs parallel to and makes extensive Van der Waals contacts with a straight stretch of three glycines (Gly351-Gly352-Gly353), also making a hydrogen bond between the agmatine amino group and the O atom of Gly351. These glycines are a part of the conserved sequence (G/A)GGNIH C ITQQ(E/Q)P, which includes the catalytic cysteine (underlined) and which can be considered a signature of AgDI. The four-carbon portion of the molecule of agmatine is also surrounded by the indolic rings of the invariant Trp93 and Trp119 (Fig. 4C), which are like flat tiles that wall the substrate binding cavity, and by the methyl group of invariant Thr215. The agmatine amino group also makes a bond with the γ-COO⁻ of Glu214 (Fig. 4C), a residue that may play a key role in making the enzyme extremely selective against arginine, since it would not favor placing near it another negatively charged group as would be the case for the carboxylate group of arginine. In any case, the region that surrounds carbon 1 of agmatine is packed with predominantly hydrophobic groups, leaving no room for a carboxyl or for any other group of substantial size, and less so if the group is polar and charged as in an α-carboxylate. On the opposite end of the agmatine molecule, around the guanidinium group, the invariant residues Asp96, His218, and Asp220 surround the bound substrate and play catalytic roles (Fig. 4C and D) (see below).

The covalent adduct provides a snapshot of AgDI catalyzing its reaction.A close examination of the electron density around the Cξ atom of agmatine (Fig. 4D) shows that this carbon is covalently linked with the S atom of Cys357 (C-S bond distance, 1.79Å ) and with two nitrogens (Nε and Nξ2). The Cξ in our structure is somewhat displaced from the plane formed by its three covalent ligands (S, Nε, and Nξ2 atoms) towards a water molecule (W1, Fig. 4D) which is located at only 2.5 Å (a very short distance for nonbonded C and O atoms). The water molecule is fixed by hydrogen bonds to one O atom of each of the two side chain carboxylates of Asp220 and Asp96 and to theδ 1N atom of His218. In turn, the ε2N of His218 is linked to the γ-COO⁻ of Glu157. A similar adduct was reported with ADI within a complex which replicates essentially all of the details of the present complex, including the presence and the interactions of the fixed water (9). This complex was interpreted to represent the covalent amidino complex proposed long ago to be formed in the mechanism of ADI (9, 16). Therefore, the present complex is highly indicative of a common, very strictly conserved mechanism of deimination by ADI and AgDI. This mechanism (Fig. 5) involves two tetrahedral intermediates but only one amidino adduct. Nevertheless, the amidino adduct must exist first in the presence of the leaving ammonia and later in the presence of the attacking water. Thus, the W1 molecule could also correspond to ammonia, and the present adduct may represent either the amidino compound with the leaving ammonia or the same compound with the attacking water.

• Open in new tab
• Download powerpoint

FIG. 5.

Proposed five-step mechanism for the AgDI reaction. Step 1 leads to the formation of the first tetrahedral carbon center intermediate as a consequence of the attack by the activated thiol of Cys357. Asp96 and the nonprotonated primary N of the guanidinium group may induce deprotonation of the thiol group. A proton is extracted by His218, which forms a charge relay system with Glu157. In step 2 the tetrahedral intermediate collapses to the triagonal amidino intermediate, with liberation of ammonia. Asp96, Asp220, and His218 help stabilize the leaving ammonia and the positive charge development in the amidino group. In step 3 ammonia is replaced by water positioned for attack on the carbon center, interacting with the same groups as the ammonia. The intermediate revealed here by X-ray crystallography corresponds to one of the two complexes (either the ammonia or the water complex) with the amidino intermediate. Step 4 is the formation of the second tetrahedral carbon intermediate. His218 helps this step by abstracting one proton from water. The final step is the collapse of the tetrahedral intermediate to carbamoylputrescine and the regenerated thiol group.

Architecture of the AgDI tetramer.In accordance with the conclusions derived from gel filtration data, AgDI is organized as a tetramer. This tetramer has tetrahedral shape, with the four subunits located in the vertices (Fig. 4G), and can be considered to be composed of two identical dimers, each of them (Fig. 4F) built by a 180° rotation of the monomer around an axis that is approximately parallel to the fivefold pseudosymmetry axis. Thus, this dimer has the aspect of two fans in battery. The interactions in this dimer are mediated by the elements of the first and second repeats, with the edge of the more external β strand of the first repeat interacting with the C-terminal two turns of α helix 4, the helix belonging to the second repeat. These interactions are generally hydrophobic in the core region and polar towards the periphery, and the surface involved amounts to an average of 991 Ų per monomer (determined with a probe radius of 1.4 Å) or ∼6.9% of the surface of each monomer. The two subunits in the dimer leave a valley between them (Fig. 4F) in the loop-rich face. It is this valley which is used for tetramer formation by having the valley of one dimer interact in a crossed-over way with the valley in the other dimer, so that the twofold axes of the two dimers are coincident and the longest axes of the two dimers run in perpendicular directions (Fig. 4G). One subunit (called A for the purpose of this description) of one dimer interacts with the two subunits of the other dimer (here called C and D). The N termini of helices 2 from A and C interact mutually, and residues 286 to 289 of the long hairpin loop that connects repeats 4 and 5 of A interact with the outer surface of helix 3 and also with the N-terminal turn of helix 2 of C, and vice versa. The interactions between A and D are restricted to mutual hydrophobic contacts between the long loop of repeat 2 of both subunits. The buried surface per monomer is 639 Ų for the interactions between A and C and only 252 Ų for those between A and D. Overall, each monomer has in the tetramer a buried surface of 1,927Å ², accounting for 13.5% of its total accessible surface area and explaining the stability of the enzyme tetramer that has been observed in the present studies.