ABSTRACT
The predicted amino acid sequence of Bacillus subtilis ycsK exhibits similarity to the GDSL family of lipolytic enzymes. Northern blot analysis showed that ycsK mRNA was first detected from 4 h after the onset of sporulation and that transcription of ycsK was dependent on SigK and GerE. The fluorescence of the YcsK-green fluorescent protein fusion protein produced in sporulating cells was detectable in the mother cell but not in the forespore compartment under fluorescence microscopy, and the fusion protein was localized around the developing spores dependent on CotE, SafA, and SpoVID. Inactivation of the ycsK gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, lysozyme, or chloroform. The germination of ycsK spores in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride and LB medium was also the same as that of wild-type spores, but the mutant spores were defective in l-alanine-stimulated germination. In addition, zymogram analysis demonstrated that the YcsK protein heterologously expressed in Escherichia coli showed lipolytic activity. We therefore propose that ycsK should be renamed lipC. This is the first study of a bacterial spore germination-related lipase.
Members of the gram-positive Bacillus and Clostridium species produce metabolically dormant endospores in response to unfavorable conditions. Bacterial endospores are resistant to severe physical and chemical conditions, including heat, UV light, lytic enzymes, and solvents. These properties are attributed mainly to the unique structure of the spore coat and cortex, as well as to the physical state of the spore core (34). Despite the resistance properties, spore germination is triggered by specific germinants and leads to the irreversible loss of spore dormancy, followed by outgrowth and the formation of a vegetative cell. Spore germination is controlled by the sequential activation of a set of preexisting germination-related enzymes but not by protein synthesis (15, 31) and is clearly governed by a new class of sensory and transducer systems (38).
The Bacillus subtilis genome-sequencing project revealed about 4,100 protein-encoding genes (21), and B. subtilis has been used as a model organism to understand metabolism, cell division, and macromolecular synthesis, mainly using genetic approaches. Among the many types of cellular development and differentiation, sporulation is one of the best understood. The temporal and spatial control of gene expression, intracellular communication, and various aspects of cell morphogenesis during sporulation has been studied in detail (13), but the mechanism of germination is still unclear. Many gene products involved in germination have been identified and characterized: receptor-like proteins (defined as ger family proteins), spore coat proteins, cortex-lytic enzymes, and so on (10, 26, 42). These mutants blocked various stages of spore germination. Recently, Kawai et al. demonstrated that spore membranes of B. subtilis Marburg had a significantly higher cardiolipin content than the membranes of exponentially growing cells and suggested that the lipid composition of spore membranes affects spore germination as well as defects of the spore coat (20). Despite such significance of lipid composition in spores, the roles of lipid biosynthesis and metabolism in spore formation and/or germination remain to be studied.
Many sporulation-specific genes have been revealed by using lacZ fusions as reporters (22). Of these genes, we found an open reading frame (ORF), ycsK, whose predicted product has the consensus motif of the GDSL family of lipolytic enzymes. We describe here that expression of ycsK is dependent on SigK and GerE during sporulation and that its product is a component of spore coat proteins. In addition, the properties of the mutant spores and zymogram analysis suggested that YcsK is a novel lipolytic enzyme involved in spore germination.
MATERIALS AND METHODS
Bacterial strains, plasmids, media, and general techniques.The B. subtilis and Escherichia coli strains and plasmids used in this study are listed in Table 1. We used a Campbell-type single-crossover recombination method to construct a ycsK-gfp in-frame fusion. The gfp gene of pGFP7C makes an in-frame fusion at the 3′ end of this plasmid with the sequence encoding a six-His tag (24). The oligonucleotide primers YCSK20 (5′-GAT GGATCC CTCTGGGCGATTCCTTGA-3′; the BamHI site is underlined) and YCSK638R (5′-GTT CTCGAG GAAACTGATAATTCTTTATAGC-3′; the XhoI site is underlined) were used to amplify the ycsK gene fragment from the B. subtilis 168 chromosome. The PCR product was digested at the BamHI and XhoI sites introduced by the primers and then inserted into BamHI/XhoI-digested pGFP7C to create plasmid pYCSK8G. Strains 168, COTE5E, SAFA5E, and S6D5E were transformed with this plasmid by a single-crossover recombination with selection for chloramphenicol resistance (5 μg/ml), yielding strains YCSK8G, YCSK8GCOTE, YCSK8GSAFA, and YCSK8GS6D, respectively (Table 1). The recombination of DNA was confirmed by PCR. The Japanese and European Consortia for Functional Analysis of the B. subtilis Genome constructed YCSKd (Table 1).
Bacterial strains and plasmids used in this study
B. subtilis strains were grown in Difco sporulation (DS) medium (Difco Laboratories, Detroit, MI) (41). The conditions for sporulation of B. subtilis were as described previously (45). Recombinant DNA techniques were carried out according to standard protocols (40). Preparation of competent cells, transformation, and preparation of chromosomal B. subtilis DNA were carried out as described previously (8).
Preparation of spores.The B. subtilis strains were grown in DS medium at 37°C as described previously (22). Mature spores were harvested 18 h after the end of exponential growth (t 18) and washed once with 10 mM Tris-HCl (pH 7.2). The spore samples were then prepared according to the procedure described by Kuwana et al. (24). To remove cell debris and vegetative cells, the pellets were suspended in 0.1 ml lysozyme buffer containing 10 mM Tris-HCl (pH 7.2) and 1% (wt/vol) lysozyme and incubated at room temperature for 10 min. In some experiments, complete protease inhibitor cocktail (Roche, Mannheim, Germany) was added to the lysozyme buffer. The pellets were then washed repeatedly with a buffer containing 10 mM Tris-HCl (pH 7.2) and 0.5 M NaCl at room temperature until cell debris and vegetative cells could not be observed microscopically. After this treatment, more than 99% of the spores were refractile, and almost no dark or gray spores were visible by phase-contrast microscopy.
RNA preparation and Northern analysis.Total RNA was prepared from B. subtilis cells as described previously (18). Northern analysis, hybridization, and detection were performed using the DIG Northern starter kit (Roche) as described in our previous report (23). RNA probes for Northern hybridization were synthesized using T7 RNA polymerase with PCR products as templates. The 0.6-kb probe for ycsK, corresponding to nucleotides 20 to 610 downstream of the translation initiation codon of ycsK, was prepared by PCR using the primers YCSK20 and YCSK610RT7 (5′- TAATACGACTCACTATAGGGCGA TGTGAACGGCTTCAGCCA-3′; the T7 promoter sequence is underlined). RNA probes specific for ycsK were labeled with the Roche digoxigenin labeling system as described previously (23).
Phase-contrast and fluorescence microscopy.Aliquots of the cultures of strains harboring the ycsK-gfp fusion on the chromosome sporulated in DS medium were transferred to a microscope slide. Fluorescence due to the green fluorescent protein (GFP) fusion protein was observed under a BX51 fluorescence microscope with a GFP mirror cube unit (Olympus, Tokyo, Japan). The images were captured with a CoolSNAP ES/OL cooled charge-coupled-device camera (Roper Scientific, Tucson, AZ) and processed with RS Image Express version 4.5 (Roper Scientific).
Spore resistance.Cells were grown in DS medium at 37°C for 18 h after the end of exponential growth (t 18), and spore resistance was assayed as described previously (45). The culture was heated at 80°C for 30 min and treated with lysozyme (final concentration, 250 μg/ml) at 37°C for 10 min or treated with 10% (vol/vol) chloroform at room temperature for 10 min, as described by Nicholson and Setlow (33). A portion of the sample was diluted in distilled water, plated on LB agar medium, and incubated overnight at 37°C. The number of survivors was determined by counting colonies.
Spore germination.Purified spores were heat activated at 80°C for 20 min, cooled, and then suspended in 10 mM Tris-HCl (pH 7.5) buffer to an optical density of 0.6 at 620 nm. Either l-alanine (10 mM) or AGFK (10 mM l-asparagine, 10 mM d-glucose, 10 mM d-fructose, and 10 mM potassium chloride) was added. The release of dipicolinic acid (DPA) was measured as described by Nicholson and Setlow (33). Germination was monitored by loss of optical density and release of DPA at 37°C for up to 120 min.
Solubilization of proteins from mature spores.Proteins were solubilized from 1 optical-density-at-600-nm unit of spores in 0.1 ml of loading buffer containing 62.5 mM Tris-HCl (pH 6.8), 10% (wt/vol) sodium dodecyl sulfate (SDS), 10% (vol/vol) 2-mercaptoethanol, 10% (vol/vol) glycerol, and 0.05% (wt/vol) bromophenol blue at 95°C for 5 min (22). A Bio-Rad RC DC protein assay kit was used to measure the amount of protein in the sample. The proteins were separated by 14% SDS-polyacrylamide gel electrophoresis (PAGE), and immunoblotting was performed using rabbit immunoglobulin G against GFP.
Expression of YcsK in E. coli.The ycsK gene was PCR amplified with the primers exYCSK1 (5′-TTTT CATATG GTGCTTCGATATACAGC-3′; the NdeI site is underlined) and exYCSK2 (5′-ATTT GGATCC TATGAAACTGATAATTCTTTAT-3′; the BamHI site is underlined). The resultant PCR product was digested with NdeI and BamHI and cloned between the same sites of pET22b(+) (Novagen, Madison, WI), yielding plasmid pET-YcsK. E. coli BL21(DE3) cells transformed with the plasmid were cultured, the expression of YcsK was induced by the addition of 1 mM isopropyl β-d-thiogalactopyranoside (IPTG) at 37°C for 3 h, and the cells were then collected by centrifugation. The cells were solubilized in 1× SDS sample buffer and boiled for 5 min. The resulting samples were subjected to SDS-PAGE.
SDS-PAGE and zymography.SDS-PAGE was performed according to the method of Laemmli (25), using 12% polyacrylamide gels. After electrophoresis, the gel was stained with Coomassie brilliant blue. To determine the lipolytic activity, zymogram analysis was performed. After the SDS-PAGE, the proteins were renatured by incubating the gel in renaturation buffer containing 20 mM Tris-HCl (pH 7.6) and 2.5% Triton X-100 for 30 min, followed by incubation for 30 min in 50 mM potassium phosphate buffer (pH 7.0). Finally, the renaturated gel was incubated in a solution containing α-naphthyl octanoate (Sigma, St. Louis, MO) and Fast Red TR hemi(zinc chloride) salt (Sigma), and the lipolytic activity was visualized as a red band (44).
RESULTS
Sequence analysis.In the 17,484-bp sequence around the 39° region of the B. subtilis chromosome, 17 ORFs were identified in the B. subtilis genome-sequencing project (1). The ycsK gene was 639 bp in length and encoded a mature peptide of 213 amino acids with a predicted molecular mass of 23.6 kDa. The search for protein family signature sequences and conserved domains in the Pfam database identified highly conserved sequence blocks of amino acid similarity and a similar position relative to that of the GDSL family of lipase/acylhydrolase proteins (48). In comparison to that of the true lipases (2), the consensus motif of the GDSL family of lipolytic enzymes is located much closer to the amino terminus within the first conserved sequence block. In B. subtilis YcsK, the active-site catalytic triad proposed by Brumlik and Buckley (5) is formed by the amino acids serine, aspartate, and histidine, located at positions 11, 83, and 189 in blocks I, III, and V, respectively (Fig. 1). Recently, Molgaard et al. classified a subgroup of this GDSL family as SGNH hydrolases due to the presence of four strictly conserved residues, Ser-Gly-Asp-His, in four conserved blocks, I, II, III, and V (32). Based on the similar sequence position and context of the catalytic triad, B. subtilis YcsK also belongs to the SGNH hydrolase family (Fig. 1). YcsK does not contain a putative signal sequence, suggesting that it is probably not a secreted enzyme.
Sequence comparison between B. subtilis YcsK and members of the GDSL family of lipolytic enzymes. Identical amino acids are shaded in black, and each number in parentheses represents the number of amino acid residues between the conserved blocks. The putative catalytic triad residues are marked (*), and the GDSL consensus motif is underlined. The putative catalytic triad residues and Gly in block II (marked with a black triangle) are conserved in the SGNH hydrolase family.
A BLAST search of GenBank with the YcsK sequence revealed close identity to conserved proteins from Bacillus anthracis (BA2501), Bacillus cereus (BC2449), and Bacillus licheniformis (BLI00504). In addition, the amino acid sequence of YcsK exhibits 28% identity with that of B. subtilis YpmR. B. subtilis YpmR also contains the GDSL motif and the putative catalytic triad, and it belongs to the GDSL family of lipolytic enzymes. However, our preliminary results suggested that the ypmR gene was not expressed during sporulation (data not shown).
Expression of the ycsK gene.Kuwana et al. suggested that when a lacZ fusion gene is used as reporter, only the ycsK gene is expressed during sporulation and the expression is controlled by a sporulation-specific sigma factor, SigK (22). Recently genomewide analysis provided an overall picture of the pattern of gene expression in sporulating cells of B. subtilis (43). According to the results, the ycsK gene is included in the SigK regulon, and the nucleotide sequence around the ycsK promoter is similar to the consensus sequence of the −35 and −10 promoter region recognized by SigK-containing RNA polymerase in B. subtilis. To further confirm the expression pattern and transcription unit of ycsK, total RNA was isolated from B. subtilis 168 and analyzed by Northern hybridization. With use of a probe specific for ycsK, the transcript was first detected from t 4 of sporulation (Fig. 2B), and the size of the transcript was approximately 0.7 kb, which is consistent with the size of the ycsK coding region (639 bp). The majority of genes expressed during sporulation are transcribed by RNA polymerase containing sporulation-specific sigma factors (13). In order to determine which sigma factor was concerned with transcription of ycsK, we performed Northern blot analysis with total RNA prepared from sigma factor-deficient mutants and from a gerE mutant at t 6 of sporulation. The 0.7-kb mRNA detected with the ycsK probe was not found in the spoIIAC, spoIIGAB, spoIIIG, spoIVCB, and gerE mutants, which are deficient in SigF, SigE, SigG, SigK, and GerE, respectively (Fig. 2B). Thus, the results suggest that transcription of ycsK occurs monocistronically under the control of SigK and is regulated positively by GerE.
Northern blot analysis of ycsK mRNA. (A) Genome structure surrounding the ycsK gene and sizes of ORFs. The arrow indicates the direction of transcription. (B) Total RNA was prepared from sporulating cells, and mRNAs were detected by Northern hybridization using probes specific for ycsK. The arrowhead indicates the position of ycsK mRNA hybridized with the digoxigenin-labeled RNA probe (0.65 kb). Transcription of ycsK for strain 168 (lanes 1 to 9), sigF mutant (lane 10), sigE mutant (lane 11), sigG mutant (lane 12), sigK mutant (lane 13), gerE mutant (lane 14), or ycsK mutant (lane 15) cells was analyzed by Northern hybridization. The time (h) after the onset of sporulation is shown at the top.
Characterization of ycsK mutant spores.In order to elucidate the role of YcsK, we analyzed the properties of the ycsK mutant. The vegetative growth rate of the ycsK mutant YCSKd in DS medium was the same as that of wild-type cells (data not shown). Mature spores prepared from the medium after 24 h of cultivation at 37°C also showed resistance to heat, lysozyme, and chloroform, as did the wild-type spores (data not shown). The remarkable difference between the ycsK mutant and wild-type cells was the spore germination response. The ycsK mutant spores decreased their optical density in germination with AGFK and LB medium, just as the wild-type spores did (data not shown). However, the response of the mutant spores to germinant l-alanine was much lower than that of the wild-type spores (Fig. 3A), with mutant spores releasing only 30% to 40% of the amount of DPA released by the wild-type spores after incubation with l-alanine for 120 min (Fig. 3B). Using phase-contrast microscopy, we confirmed that almost all of the wild-type spores became phase bright to dark (fully germinated) after 90 min of incubation with l-alanine; in contrast, most of the mutant spores stayed phase bright (77%) and 23% of the mutant spores became phase dark under the same conditions. These results suggested that YcsK is required for the progress of the l-alanine-stimulated germination of spores.
Germination properties of spore suspensions of B. subtilis 168, YCSKd, and YCSK8G. (A) Spore germination was monitored by measuring the optical density at 620 nm after the addition of l-alanine as a germinant. The efficiency of germination is expressed as relative absorbance. (B) Release of DPA was measured after addition of l-alanine as described in Materials and Methods. Squares, 168; diamonds, YCSKd; circles, YCSK8G.
Localization of YcsK-GFP.The proteomics approach has suggested that YcsK is a novel spore protein and possibly assembles on the spore coat (22). To further investigate the localization and the assembly into the spore coat, we introduced an in-frame fusion of gfp to ycsK into the B. subtilis 168 chromosome and observed the sporulating cell and the dormant spore under a fluorescence microscope. During sporulation of strain YCSK8G, fluorescence formed a shell around the forespore at t 8 but not in the mother cell compartment (Fig. 4A), and the shell was retained around the dormant spore's periphery (data not shown). The results from the expression pattern of the ycsK gene (Fig. 2B) and the localization pattern of YcsK-GFP indicate that YcsK is a typical spore coat protein. In addition, the results raised a question as to what is involved in the assembly and localization of YcsK, since there are important proteins, CotE, SafA, and SpoVID, involved in spore coat morphogenesis of B. subtilis (4, 35, 45, 50). We therefore introduced the ycsK-gfp fusion into chromosomes of cotE, safA, and spoVID mutants to investigate the localization of YcsK-GFP in the mutant strains. In the cotE, safA, and spoVID mutants, YcsK-GFP was abnormally observed in the mother cell compartment and/or around the outside of the forespore (Fig. 4B to D). The fluorescence of YcsK-GFP in the cotE mutant appeared to be slightly decreased, probably due to the impaired stability of the fusion protein. These observations suggest that YcsK-GFP is synthesized in the mother cell compartment and assembles into the spore coat in a cotE-, safA-, and spoVID-dependent manner during sporulation.
Detection of YcsK-GFP fusion in sporulating cells. The wild-type (A) or mutant cotE (B), safA (C), or spoVID (D) strain carrying the yscK-gfp fusion was grown in DS medium at 37°C, and the cells were collected 8 h after the onset of sporulation. The cells were analyzed by phase-contrast microscopy (left panel) or fluorescence microscopy (right panel).
Strain YCSK8G showed spore resistance (data not shown) and germination properties (Fig. 3A and B) similar to those of the wild-type spores. Additionally, immunoblot analysis with anti-GFP antibody revealed YcsK-GFP (approximately 51 kDa) in the protein extracts from strain YCSK8G spores (Fig. 5). The results suggest that the YcsK-GFP fusion protein was functional during sporulation and/or germination and that the assembly of the fusion is likely to reflect the assembly of the native YcsK.
Immunochemical identification of YcsK-GFP. Cells were cultured for 24 h in DS medium at 37°C. Purified spores were prepared in lysozyme buffer containing a complete protease inhibitor cocktail (Roche). Protein samples (10 μg) were solubilized from wild-type (lane 1) or ycsK-gfp (lane 2) spores. The samples were resolved by 14% SDS-PAGE, and immunoblotting was performed with anti-GFP antiserum. The arrowhead shows the position of YcsK-GFP (51 kDa).
Lipolytic activity of recombinant YcsK.The YcsK protein belongs to the GDSL family of lipolytic enzymes on the basis of sequence homology (Fig. 1), but it is uncertain whether the product of the ycsK gene exhibits lipolytic activity. To examine the lipolytic activity of YcsK, we overproduced the protein in E. coli and performed zymogram analysis as described in Materials and Methods. The ycsK gene was cloned under the control of the IPTG-inducible T7lac promoter, and the resultant plasmid was introduced into E. coli BL21(DE3) for overproduction. Following the induction of E. coli with 1 mM IPTG for 3 h, the cells were harvested and solubilized in 1× SDS sample buffer. When the cell lysate was subjected to SDS-PAGE, an intense band of approximately 24 kDa, corresponding with the calculated mass of YcsK, was observed in Coomassie blue-stained gels (Fig. 6, lane 2). The renatured SDS-polyacrylamide gel was overlaid with the substrate α-naphthyl octanoate in order to visualize the activity of the lipase. The zymogram analysis identified the 24-kDa protein as a lipolytic enzyme (Fig. 6, lane 5). Taken together with the sequence analysis (Fig. 1), this result provides strong evidence that YcsK is a GDSL-type lipolytic enzyme.
SDS-PAGE and zymography of proteins from whole cells of E. coli BL21(DE3) harboring pET-22b(+) or pET-YcsK. Lanes 1 to 3 on SDS-PAGE correspond to lanes 4 to 6 on zymography. Lane M, molecular mass marker proteins (Nakalai Tesque, Kyoto, Japan); lanes 1 and 4, pET-22b(+); lanes 2 and 5, pET-YcsK; lanes 3 and 6, bovine serum albumin (5 μg). Lipolytic activity was visualized as described in Materials and Methods. The arrowhead indicates the position of the YcsK protein.
DISCUSSION
More than 40 proteins make up the spore coat of B. subtilis, which protects the spore from numerous assaults. Mutations in a significant number of coat protein genes result in germination-defective spore germination phenotypes (10, 16, 30, 46). However, the actual catalytic activities of most of those coat proteins remain unknown. In this study, we demonstrated that the product of the ycsK gene, involved in germination, showed lipolytic activity. Our preliminary analysis of a purified recombinant YcsK protein indicated that the protein actually hydrolyzes phospholipids (data not shown). We therefore propose that ycsK should be renamed lipC.
B. subtilis lipC (ycsK) spores were unable to complete spore germination mediated by l-alanine, though the mutation has no effect on their resistance to heat, lysozyme, and chloroform. Spore germination of B. subtilis is generally triggered by three specific germinants, l-alanine, AGFK, and Ca2+-DPA (42). Each of these germination processes in response to a specific germinant is required for the function of germinant receptor-like proteins encoded by ger genes, and the germination signal probably results from an interaction of germinants with specific sites of receptors (15, 31, 42). Recently, immunological studies showed that GerBA of B. subtilis is located in the spore inner membrane (37). Similar experimental approaches have suggested that GerAA and GerAC are also localized in the same membrane (17). These results would be consistent with the fact that the primary sequences of the proteins encoded by gerA/B/K operons contain several putative transmembrane domains or lipoprotein signal peptides (47). However, these findings raise an intriguing question in regard to the germination trigger reaction. That is, how do the germination signals gain access to the germination receptors located at the inner spore membrane? The notion that the germination receptors are located in the inner membrane fits with the retention of the specificity of the germination response in coat-defective or coat-stripped spores. On the other hand, the integrity of the outer spore membrane has been questioned. The outer membrane is ill defined in electron micrographs, and it seems likely that this membrane is also ineffective as a permeability barrier in coat-defective mutant spores (7, 27, 37). It is unclear whether the outer membrane remains intact in spores. In the present study, we demonstrated that the novel lipolytic enzyme LipC is expressed in the mother cell compartment at the late stage of sporulation and localizes around forespores in a CotE-, SafA-, and SpoIVD-dependent manner. Costa et al. demonstrated that a functional OxdD-GFP fusion protein assembles into spore coats in a SafA- and SpoVID-dependent manner and suggested that OxdD localizes in the inner layer of the coat (6). Since SpoVID recruits SafA and SafA localizes to the cortex-coat interface in mature spores (35, 36), LipC may be targeted to the same location around the outer membrane, dependent on SafA. If so, it may be reasonable to hypothesize that the role of LipC is to modify lipids in the outer membrane during sporulation and/or germination. It is likely that the germination machinery requires coat integrity to function correctly (10). Although we analyzed the spore proteins of the lipC mutant by SDS-PAGE, the protein profile of lipC spores was similar to that of wild-type spores (data not shown). To clear up the cause of the germination defect in lipC spores, analysis of the lipid composition in dormant spores, germinated spores, and germination exudate of the mutant remains a topic for future study.
Most bacterial lipases are extracellular enzymes, which must be translocated through the membranes to reach their final destination. Therefore, they possess an N-terminal signal sequence that mediates their secretion. B. subtilis also secretes two lipases, LipA and LipB, into the culture medium (9, 11). These enzymes have been characterized in detail by biochemical, genetic, and structural studies (9, 11, 12, 49). B. subtilis LipA is produced as an active enzyme during vegetative growth (11), and it has also been identified from B. subtilis spores by the liquid chromatography-tandem mass spectrometry method (22), whereas the LipA activity was not detected in the germination exudate of B. subtilis spores. Since we generally perform heat treatment before spore germination, the treatment might inactivate LipA located at the spore surface.
Lipases and esterases have attracted considerable interest from industry because of their biotechnological potential. The wide range of properties with respect to substrate specificity and regio- and enantioselectivity has opened a broad spectrum of applications for these hydrolytic enzymes (19). Additionally, the lipolytic enzymes of the GDSL family play important roles in the bacterial metabolic pathway and as virulence factors (28, 39). In the case of microbial cell-cell signaling, EstA, a secreted GDSL esterase of Serratia liquefaciens, may be important for providing the cell with precursors required for N-acyl-homoserine lactone biosynthesis under certain growth conditions (39). In Legionella pneumophila, two GDSL-type secreted lipases, PlaA and PlaC, were identified (3, 14). PlaA cleaves fatty acids from lysophospholipid but not phospholipid containing both fatty acids (14), and PlaC possesses multifunctional properties, including phospholipase, lysophospholipase, lipase, and glycerophospholipid-cholesterol acyltransferase activities (3). Interestingly, Kawai et al. revealed that the spore membranes of B. subtilis Marburg have a significantly higher cardiolipin content than the membranes of exponentially growing cells (20). It has been suggested that cardiolipin plays specific roles in essential cellular processes, including initiation of DNA replication and cell division (29). Further studies will be needed to determine the precise physiological role and function of B. subtilis LipC.
FOOTNOTES
- Received 30 September 2006.
- Accepted 3 January 2007.
- Copyright © 2007 American Society for Microbiology
