Lipoprotein Signal Peptides Are Processed by Lsp and Eep of Streptococcus uberis

Identification of lipoprotein sequences by pattern searching.Lipoproteins from the genome of S. uberis strain 0140J (http://www.sanger.ac.uk/Projects/S_uberis/ ) were found using a slight modification of the G+Lpp published by Sutcliffe and Harrington (37). The pattern [MV]-X(0,13)-[RK]-, (6,20)-[LIVMFESTAG]-[LVIAMF]-[IVMSTAFGC]-[AG]-C (I. C. Sutcliffe, personal communication) was entered in the pattern search option of the PEDANT website (15, 16), and the proteins were cross referenced with the open reading frames (ORFs) predicted by the Sanger Centre annotation (M. Holden, personal communication). Candidate proteins were checked to determine that the pattern was located at the N terminus of the protein and that a signal peptide sequence could be predicted using SignalP (4). Putative functions for each of the predicted lipoproteins were ascribed using the BLASTp algorithm (1) (http://www.ncbi.nlm.nih.gov/BLAST/ ).

Bacterial growth conditions and oligonucleotide primers. S. uberis was routinely grown on Todd-Hewitt agar or sheep blood-esculin agar plates and in Todd-Hewitt broth (THB; Oxoid, Basingstoke, United Kingdom) at 37°C as a standing culture. Uncured pGh9⁺::ISS1 mutants were grown in the same medium with the addition of 1 μg/ml erythromycin at 37°C. Oligonucleotide primers P432 (GCTCTTCGGATTTTCGGTATC) and P571 (AATATCTTCAGCTTCATAATCC) were used to amplify the lsp locus, and primers eep fwd (TCAGTTTGGAGACTTAGTGG) and eep rev (TTTCATTTATCTGTATTTCTCC) were used to amplify the eep locus of S. uberis. Oligonucleotide primers P358 (CATTTTCCACGAATAGAAGGACTGTC) and P247 (GCTCTTCGGATTTTCGGTATC) were used to screen pGh9⁺::ISS1 mutant banks, as described below, and a digoxigenin-labeled ISS1 probe was used for Southern blotting as described previously (48).

Growth of S. uberis in the presence of globomycin.A stock of globomycin (kindly supplied by Shunichi Miyakoshi, Sankyo Company Ltd., Japan) was prepared at a concentration of 10 mg/ml in ethanol and stored at −20°C. Bacteria were grown overnight in THB, prior to dilution in fresh THB to an optical density at 550 nm of 0.01. Cultures were grown at 37°C to the start of exponential phase (optical density at 550 nm of 0.1) before the addition of globomycin to 100 μg/ml. Bacteria were harvested at appropriate time points by centrifugation (12,000 × g, 5 min, 4°C). Whole-cell lysates and trichloroacetic acid supernatant precipitates were prepared.

Preparation of chromosomal DNA from S. uberis.Chromosomal DNA from 3 ml of culture was prepared by using a variation of the method of Hill and Leigh (18). Bacteria were harvested by centrifugation (10,000 × g, 5 min), and the cell pellet was washed with 500 μl of 10 mM Tris-Cl-5 mM EDTA (pH 7.8). Bacterial cell walls were disrupted by resuspending bacteria in 375 μl of 10 mM Tris-Cl-5 mM EDTA (pH 7.8) containing 30 U/ml mutanolysin (Sigma) and 10 mg/ml lysozyme (Sigma). The bacterial suspension was incubated at 37°C for 30 min. Total cell lysis was achieved by addition of 20 μl of a sodium dodecyl sulfate solution (20% [wt/vol] in 50 mM Tris-Cl, 20 mM EDTA, pH 7.8) and proteinase K (Sigma) at a final concentration of 150 μg/ml and incubation at 37°C for 1 h. Cell wall material was precipitated by the addition of 200 μl of saturated NaCl solution and subsequent centrifugation (13,000 × g, 15 min, 4°C). The cleared supernatant was transferred to a clean tube, and contaminating proteins were removed by phenol-chloroform extraction. The DNA was precipitated by addition of 2 volumes of absolute ethanol. DNA pellets were washed with 70% aqueous ethanol and air dried prior to resuspension in Tris-EDTA buffer containing 20 μg/ml of RNase A (Sigma).

Southern blotting to determine location and distribution of ISS1 insertion.Southern blot analysis was performed upon genomic DNA digested with EcoRI or HindIII. Hybridization of the digoxigenin-dUTP (Roche Diagnostics Ltd.)-labeled probe was carried out at 65°C overnight. Hybridizing fragments were visualized with the chemiluminescent substrate nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (Roche Diagnostics Ltd.) as instructed by the manufacturer.

Isolation of mutants from an S. uberis strain 0140J pGhost9⁺::ISS1 mutant bank.PCR amplification was carried out on DNA from pools of 96 mutants representing a single microtiter tray from an S. uberis strain 0140J pGh9⁺::ISS1 mutant bank, comprised of 8,800 individual clones (39). A screen for ISS1 insertions at a specific locus was carried out by PCR using paired ISS1 and gene-specific primers as first described by Taylor et al. (39). Amplification was carried out using 2 U Taq polymerase (New England Biolabs). Each pooled DNA sample was screened twice using a gene-specific primer (listed above) with either P247 or P358 to enable detection of chromosomally inserted ISS1 in either orientation at the relevant locus. Clones from individual wells were cultured to obtain single colonies and cured as previously described (48); the presence of the ISS1 insertion was confirmed by Southern blotting, described above.

Sequence analysis to define the ISS1 insertion point (48) was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, United Kingdom), according to the manufacturer's instructions. Sequence determination was carried out by L. Richardson (University of Oxford, United Kingdom).

Random mutagenesis in lsp mutant S. uberis.The procedures described previously by Maguin et al. (30) and Smith et al. (36) were used to generate a bank of random mutants within the lsp mutant of S. uberis by using the pGh9⁺::ISS1 vector. Isolation of a mutant carrying an insertion within eep was conducted as described above for isolation of mutant strains carrying single lesions.

Preparation of cleared whole-cell lysates.Bacteria were harvested from cultures (2 ml to 100 ml) at required time points by centrifugation (12,000 × g, 5 min), and the pellets were washed three times in an equal volume of phosphate-buffered saline (PBS). Washed cells were suspended in 100 to 500 μl of PBS and mixed with 170- to 180-μm-diameter glass beads (0.5 g; Braun Biotech International). Bacteria were disrupted by rapid agitation (twice for 40 s each) by using a Cell Homogenizer-MSK instrument (Braun Biotech International). During disruption, samples were cooled with liquid CO₂. Following disruption, samples were kept on ice for 1 h in the presence of 1% (vol/vol) Triton X-100 (BDH). Cell debris, unbroken cells, and beads were removed by centrifugation (12,000 × g, 5 min), and the supernatant was stored at −20°C.

Subcellular fractionation of S. uberis.The following fractionation procedures were used sequentially on 100-ml cultures. All buffers contained 1× Complete EDTA-free protease inhibitors (Roche Diagnostics Ltd., United Kingdom).

Preparation of capsule fraction.Bacteria were harvested by centrifugation (11,500 × g, 10 min). The supernatant was discarded, and the pelleted bacteria were resuspended and washed three times in 10 ml ice-cold PBS (0.01 M phosphate buffer, 0.0027 M potassium chloride, and 0.137 M sodium chloride, pH 7.4, at 25°C) with a final resuspension in 250 μl PBS containing hyaluronidase (100 U ml⁻¹; Sigma). Bacteria were incubated for 2 h at 37°C, and cells were collected by centrifugation (9,500 × g, 5 min). The supernatant fraction (capsular extract) was removed and stored at −20°C.

Preparation of cell wall fraction.Cells harvested from the capsule preparation procedure were resuspended and washed three times in 1 ml ice-cold PBS before being resuspended in 250 μl PBS containing 40% (wt/vol) sucrose and 170 U mutanolysin (Sigma). Samples were incubated for 2 h at 37°C, and intact bacterial cells were harvested by centrifugation (400 × g, 15 min, 4°C) while the supernatant fraction (cell wall extract) was removed and stored at −20°C.

Preparation of cell content fraction.The pellet from the cell wall preparation (see above) was resuspended and washed three times in 1 ml ice-cold PBS containing 40% (wt/vol) sucrose with a final resuspension in 250 μl membrane buffer (100 mM Tris-HCl, pH 7.5, 10 mM MgCl₂, 100 mM NaCl). The cell protoplasts were freeze-thawed (−80°C to +37°C) three times to promote cell lysis. Residual intact cells and debris were removed by centrifugation (9,500 × g, 5 min, 4°C), and the supernatant fraction (cell contents) was harvested and stored at −20°C.

Preparation of membrane fraction.The pellet remaining from the cell content procedure was resuspended and washed three times in 1 ml cold PBS, with a final resuspension in 250 μl membrane buffer containing Triton X-100 (1%, vol/vol) prior to incubation at room temperature (20°C) for 1 h to solubilize the membrane components. Insoluble debris was removed by centrifugation (9,500 × g, 5 min, 4°C), and the supernatant fraction (membrane extract) was harvested and stored at −20°C.

Quantitation of protein within cell fractions.The protein content of cell fractions was determined using the bicinchoninic acid protein assay kit (Perbio) as directed by the manufacturer. Protein concentrations were calculated from mean values of triplicate readings for each sample by using a standard curve prepared using bovine serum albumen.

Detection of MtuA within cell fractions prepared from S. uberis.The proteins present in cell fractions (1 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 12.5% gels or 10% Bis-Tris gels (Invitrogen) and detected by Western blotting using MtuA antiserum (24) at a concentration of 1:2,500 and a secondary goat anti-rabbit-horseradish peroxidase conjugate (Sigma) at a concentration of 1:2,500.

Bioinformatic analysis of the complete genome of S. uberis strain 0140J for genes encoding putative lipoproteins.Thirty-one ORFs were predicted to encode lipoproteins, using the G+Lpp search pattern; each contained a signal peptide sequence that was predicted by SignalP (4) (see Table S1 in the supplemental material). A pattern search was also performed using the Prosite pattern PS00013 for bacterial lipoproteins which identified a further 55 proteins; however, all of these sequences were considered false positives due to incorrect/unsuitable positioning of the lipobox motif and/or the absence of a signal peptide sequence as predicted by SignalP. Where possible, a putative function was ascribed to the ORF identified by using BLAST-p (1) (see Table S1 in the supplemental material). Many of the proteins identified from S. uberis displayed homology to known lipoproteins such as ABC transporters and the chaperone protein PrsA. The amino acid sequence of the previously studied MtuA protein of S. uberis was identified as containing a signal peptide typical of lipoproteins (24, 36).

Processing of the essential lipoprotein MtuA was affected by the antibiotic globomycin.Protein samples prepared from cultures grown to the onset of stationary phase in the presence of globomycin yielded a single MtuA protein band approximately 2 kDa larger than that detected from equivalent cultures lacking the antibiotic (Fig. 1A). Analysis of samples produced from cultures incubated for 24 h (approximately 14 h after the onset of stationary phase) in the presence of globomycin revealed two proteins reactive to the MtuA antibody (Fig. 1B). The lower-molecular-weight protein (indicated by arrow 2 in Fig. 1B) corresponded in size to that detected in the absence of globomycin while the larger protein (indicated by arrow 1 in Fig. 1B) corresponded in size to that detected previously in the presence of globomycin after 14 h of incubation (Fig. 1A). MtuA was not detectable in the supernatant of wild-type S. uberis in the presence or absence of globomycin (data not shown).

• Open in new tab
• Download powerpoint

FIG. 1.

Western blot analysis of wild-type S. uberis grown in the presence and absence of the Lsp inhibitor globomycin. Globomycin (100 μg/ml) was added where appropriate to bacterial cultures at the start of exponential phase. Whole-cell lysates were prepared from bacteria cultured in the presence (lanes 3) and absence (lanes 2) of globomycin grown to the start of stationary phase (A) or for 24 h (B). Markers are shown with molecular masses (lanes 1). Arrows 1 and 2, higher- and lower-molecular-mass forms of MtuA, respectively, recognized by specific antiserum.

The lsp locus in the S. uberis genome of strain 0140J.An ORF (SUB0729) showing homology to lsp from B. subtilis (accession no. Q45479), S. aureus (accession no. P31024), E. coli (accession no. AAA24092), and L. monocytogenes (accession no. CAC99922) was identified within the genome of S. uberis strain 0140J (http://www.sanger.ac.uk/Projects/S_uberis ). Lsp of S. uberis was found to be 148 amino acids in length. The amino acid homology and conservation between the S. uberis and B. subtilis Lsp proteins were 40% and 61%, respectively. Analysis of the sequence using the transmembrane helix prediction algorithm TMHMM (http://www.cbs.dtu.dk/services/TMHMM/ ) (27) revealed the presence of the four transmembrane domains present in other Lsp proteins (see Fig. S1 in the supplemental material). The lsp locus is conserved in other genomes of streptococci including S. suis and S. pneumoniae (10, 28). In S. uberis the gene was flanked by a putative transcriptional regulator, lysR (SUB0728), and a putative ribosomal large subunit, pseudouridine synthase, rluD (SUB0730) (see Fig. S2 in the supplemental material).

Isolation of lsp mutants from an S. uberis pGh9⁺::ISS1 random mutant bank.A mutant carrying an insertion in lsp (lsp::ISS1or lsp mutant) was identified in a bank of approximately 8,800 random insertion mutants by PCR screening. DNA sequence analysis placed the ISS1 insertion at 132 bp downstream of the start codon of the lsp coding sequence (see Fig. S2 in the supplemental material). Excision of the pGh9⁺ vector from the S. uberis lsp mutant and subsequent PCR amplification across the lsp locus in the cured mutant revealed an increase in the size of the amplicon of approximately 800 bp, consistent with the presence of the residual ISS1 element within the lsp gene. The presence of only a single insertion sequence element was confirmed by Southern blotting (data not shown).

The lipoprotein MtuA localized to the membrane in the wild-type and lsp mutant strains.The putative lipoprotein MtuA was visualized by Western blotting with anti-MtuA (24) within cell fractions prepared from the wild-type and lsp mutant strains (Fig. 2). Fractions from cells grown to mid-exponential phase (Fig. 2A) revealed MtuA in the membrane-enriched fraction of both strains and additionally the cell content fraction in the lsp mutant strain. A single band corresponding to a molecular mass of approximately 37 kDa was detected in the wild type in agreement with previous data (23). However, in the lsp mutant a single band, approximately 2 kDa larger (39 kDa), was detected. The size of this band corresponds to the larger-molecular-mass band detected after the wild type had been treated with globomycin (Fig. 1). Intriguingly, analysis of samples produced from bacteria grown for 24 h revealed an additional immunoreactive band in the lsp mutant. This protein was slightly larger than the mature form seen in the wild type but smaller than that previously detected in the lsp mutant (Fig. 2B). This suggested that the alternatively cleaved form of MtuA from the lsp mutant detected at 24 h was likely to be shorter than that detected in mid-exponential cultures of the lsp mutant but longer than that detected in the wild-type strain.

• Open in new tab
• Download powerpoint

FIG. 2.

Western blot showing that MtuA in the lsp mutant localizes to the membrane. (A) Cell fractions prepared from bacteria grown to mid-exponential phase. Lanes 1 to 4, wild-type capsule, cell wall, membrane, and cell contents, respectively; lanes 5 to 8, lsp mutant capsule, cell wall, membrane, and cell contents, respectively. (B) Cell fractions prepared from bacteria grown to 24 h. Lanes 1 to 4, wild-type capsule, cell wall, membrane, and cell contents, respectively; lanes 5 to 8, lsp mutant capsule, cell wall, membrane, and cell contents, respectively. Molecular masses of markers (not shown) are displayed (kDa).

A homologue of the gene encoding the E. faecalis protein Eep (enhanced expression of pheromone) is present within the genome of S. uberis strain 0140J.The metallopeptidase Eep from Enterococcus faecalis has been shown to cleave the signal peptides of certain lipoproteins with the consequent release of short peptides that act as aggregation pheromones (3, 8, 14). This includes the peptide cAD1 (2), which is derived from the eight amino-terminal amino acids preceding the cysteine residue of the lipobox, the predicted cleavage point for Lsp (9).

A homologue of eep (accession number AAD47948) was found within the genome of S. uberis strain 0140J (ORF SUB0254) by using the BLAST algorithm (1); the identity between the predicted amino acid sequence of S. uberis SUB0254 and that of E. faecalis Eep was 304/427 (71%) (see Fig. S3 in the supplemental material). The HEXXH zinc binding signature motif, characteristic of M50A peptidases such as Eep (26), was also present in SUB0254. Eep of E. faecalis was predicted to be a membrane protein and, by use of the MEMSAT prediction software (25), was predicted to have four regions that span the membrane. An equivalent number of domains were found in SUB0254.

Identification of eep mutants within the S. uberis 0140J and S. uberis 0140J lsp mutant banks.Genotypic PCR screening of the 0140J pGh9⁺::ISS1 mutant bank (39) permitted isolation of an eep::ISS1 mutant (eep mutant) with an insertion located 362 bp downstream of the start codon of SUB0254 (see Fig. S4 in the supplemental material). Similarly, screening of an lsp mutant pGh9⁺::ISS1 mutant bank permitted isolation of a double mutant carrying an insertion 34 bp downstream of the start codon of SUB0254 (see Fig. S4 in the supplemental material). The growth of the eep and lsp/eep mutants in THB and in skimmed milk was comparable to that of the wild type (data not shown).

MtuA is not cleaved in the lsp/eep mutant.In an experiment where the lsp and lsp/eep mutants were compared directly with the wild-type strain, whole-cell lysates of the lsp mutant and lsp/eep double mutant, grown to the onset of stationary phase (approximately 8 h), revealed the presence of a single MtuA protein that corresponded to full-length MtuA (Fig. 3). In similar extracts prepared from cultures grown to late stationary phase (24 h), the lsp mutant displayed two MtuA protein bands (as previously reported for the membrane fraction [Fig. 2B]) However, in equivalent extracts prepared from the lsp/eep double mutant, only the higher-molecular-weight protein band was observed, indicating that the presence of the lower-molecular-weight form of MtuA required intact (functional) eep. In whole-cell extracts from the single eep mutant, MtuA was detected only at a size consistent with that present in the wild-type strain (Fig. 4), indicating that any cleavage of MtuA due to Eep was detected only in the absence of Lsp.

• Open in new tab
• Download powerpoint

FIG. 3.

Presence of the different forms of MtuA in the lsp mutant and the lsp/eep mutant. Lane 1, wild-type whole-cell lysate at 24 h; lane 2, lsp mutant at start of stationary phase; lane 3, lsp/eep mutant at start of stationary phase; lane 4, lsp mutant at 24 h; lane 5, lsp/eep mutant at 24 h. Molecular masses are indicated in kDa.

• Open in new tab
• Download powerpoint

FIG. 4.

MtuA is processed normally in an individual eep insertion mutant. Lane 1, wild-type 24-h whole-cell lysate; lane 2, eep mutant 24-h whole-cell lysate; lane 3, lsp mutant at 24 h; lane 4, lsp/eep mutant at 24 h; lane 5, wild-type 24-h whole-cell lysates. Molecular masses are indicated in kDa.