Whole-Genome Transcriptional Profiling of Bradyrhizobium japonicum during Chemoautotrophic Growth

William L. Franck; Woo-Suk Chang; Jing Qiu; Masayuki Sugawara; Michael J. Sadowsky; Stephanie A. Smith; Gary Stacey

doi:10.1128/JB.00543-08

DOI: 10.1128/JB.00543-08

Article Figures & Data

Figures

Tables
Additional Files

Open in new tab
Download powerpoint
FIG. 1.
Functional classification of differentially expressed genes with transcript changes greater than 1.5-fold. (A) Chemoautotrophy and heterotrophy comparison. (B) Arabinose-supplemented chemoautotrophy and heterotrophy comparison. In both panels, black bars represent the chemoautotrophic condition and gray bars represent the heterotrophic condition. Functional classifications were derived from B. japonicum genome annotations available via Rhizobase (http://bacteria.kazusa.or.jp/rhizobase/ ) and the JCVI Comprehensive Microbial Resource (http://cmr.tigr.org/tigr-scripts/CMR/CmrHomePage.cgi ).
Open in new tab
Download powerpoint
FIG. 2.
Comparison of log-transformed qRT-PCR data and microarray data of eight representative genes selected from Tables S1 to S4 in the supplemental material.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant genotype or characteristic	Source or reference
B. japonicum strains
USDA110	Wild type	USDA, Beltsville, MD
A3	nifD::Tn5	23
H1	nifH::Tn5	23
aceA mutant	aceA::Km	This study
E. coli DH5α	supE44 ΔlacU169 (φ80lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1	Bethesda Research Laboratories
Plasmids
pRK2073	RK2, Tra⁺ Sm^r	32
pKnockout-Ω (pKOΩ)	Suicide vector	50
pHP45Ω-Km	Km cassette	16
pKOΩ-ICL	pKOΩ containing 2.7-kb fragment including entire aceA gene	This study
pKOΩ-ICL-Km	Km cassette inserted into AgeI site of pKOΩ-ICL	This study

TABLE 2.

Gene-specific primers for quantitative RT-PCR

Gene ID (gene name)	Forward primer	Reverse primer
bll5403 (fusA)	ACAAGTACAAGGTTCCGCGCAT	TCAACGATGTCGGCAAGACACT
blr0305	CGACGAGCGCGCCATTCTAT	AAGGCACGTTGTTGCCGGT
blr1743 (nifD)	ACCAACAGCGTCGCAGAAATCA	TTGGTGCACGTTGAGGTGCTT
blr1769 (nifH)	TATTCTGCACGCCAAGGCTCAA	TCAACGCAGCGAATGTCCTGGTA
blr2455 (aceA)	GTCAGCGAAAGGATCAGGCACAT	TTCGCTGCATCGATCTCGCTCT
blr2585 (cbbL)	TTCGCGGCAAGGAGCGTTAT	TCGGTGTCCTTTGGCGTGTAGT
blr2588	ATCGGAAGGCGCGATCGAA	AAGCTGGGACTCGAGGAAGGA
bll6941 (hupL)	AGAACGCCAATTCGATCCGCAA	TCCAGCGCGTGAAGGTGATAGAA
bll7911	CGGCAGCATCAGTTCTACCGA	TTGCCTTGCTTCTTGCCCTTCT

TABLE 3.

B. japonicum genes significantly upregulated during chemoautotrophic growth^a

Protein function and gene ID	Gene product	Fold change
Protein function and gene ID	Gene product	C/H^b	CA/H^c
Uptake hydrogenase
hupT (bll6924)	Two-component hybrid sensor and regulator	2.77	2.70
hoxA (bll6925)	Two-component response regulator	2.43	2.60
hoxX (bll6926)	Probable HoxX protein	2.39	2.31
hypE (bll6927)	HypE protein	2.33	1.96
hypC (bsl6929)	Hydrogenase expression/formation protein	4.53	3.37
hypF (bll6930)	Hydrogenase maturation protein	1.73	1.63
hypB (bll6931)	HypB protein	3.96	3.13
hypA (bll6932)	HypA protein	5.50	3.89
hupK (bll6933)	HupK protein	1.99	1.59
hupI (bsl6935)	HupI protein	5.85	3.46
hupH (bll6936)	HupH protein	3.12	2.40
hupG (bll6937)	HupG protein	3.24	2.59
hupF (bsl6938)	Hydrogenase expression/formation protein	13.09	5.95
hupD (bll6939)	HupD protein	3.07	2.15
hupC (bll6940)	HupC protein	39.62	20.31
hupL (bll6941)	Uptake hydrogenase large subunit	11.61	7.56
hupS (bll6942)	Uptake hydrogenase precursor	29.38	19.05
hupC (bll6947)	Probable Ni/Fe-hydrogenase B-type cytochrome subunit	2.48	2.46
Respiration
atpB (bll1185)	FoF1 ATP synthase B chain	4.29	3.03
atpB (bll1186)	FoF1 ATP synthase B′ chain	5.06	3.48
atpC (bsl1187)	FoF1 ATP synthase C chain	4.26	3.15
atpA (bll1188)	FoF1 ATP synthase A chain	2.93	2.29
atpI (bsl1189)	FoF1 ATP synthase subunit I	1.57	ND^d
atpD (bll0440)	ATP synthase beta chain	1.93	1.60
atpG (bll0441)	ATP synthase gamma chain	1.72	1.52
atpA (bll0442)	ATP synthase alpha chain	2.17	1.72
coxB (blr1170)	Cytochrome c oxidase subunit II	3.50	3.26
coxA (blr1171)	Cytochrome c oxidase subunit I	2.58	2.45
coxG (blr1174)	Putative cytochrome c oxidase assembly protein	2.43	2.17
cycA (blr7544)	Cytochrome c ₅₅₀	2.74	2.65
cycM (blr1423)	Cytochrome c	1.76	ND
napC (blr7040)	Cytochrome c-type protein	2.40	ND
CO₂ fixation and carbon metabolism
cbbF (blr2581)	Putative d-fructose-1,6-bisphosphatase protein	2.37	1.80
cbbP (blr2582)	Putative phosphoribulokinase protein	6.98	4.71
cbbT (blr2583)	Transketolase	3.82	2.36
cbbA (blr2584)	Putative fructose-1,6-bisphosphate aldolase protein	9.98	5.56
cbbL (blr2585)	Ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit	14.41	7.00
cbbS (blr2586)	Ribulose 1,5-bisphosphate carboxylase/oxygenase small subunit	5.46	3.82
cbbX (blr2587)	Probable CbbX protein	7.49	4.14
cbbE (blr2588)	Ribulose-phosphate 3-epimerase	3.44	2.60
bll1137	Probable carbonic anhydrase	2.05	2.25
bll4865	Putative carbonic anhydrase	1.60	1.69
aceA (blr2455)	Putative isocitrate lyase	28.58	31.03
ppc (blr2955)	Phosphoenolpyruvate carboxylase	1.58	1.70
Nitrogen fixation and nitrogen metabolism
fdxN (bsr1739)	Ferredoxin	2.11	1.77
nifD (blr1743)	Nitrogenase molybdenum-iron protein alpha chain	4.69	3.09
nifK (blr1744)	Nitrogenase molybdenum-iron protein beta chain	3.46	2.60
nifE (blr1745)	Nitrogenase molybdenum cofactor synthesis protein	1.98	1.76
nixN (blr1746)	Nitrogenase molybdenum cofactor synthesis protein	2.62	1.92
nifX (blr1747)	Iron-molybdenum cofactor processing protein	3.14	2.54
fdxB (bsr1750)	Ferredoxin	1.84	1.57
nifH (blr1769)	Dinitrogenase reductase protein	1.85	ND
nifQ (blr1770)	Molybdenum processing protein	1.59	ND
fixC (blr1774)	Flavoprotein	1.93	1.64
Chaperone
groEL₃ (bll2059)	GroEL3 chaperonin	3.25	ND
groES₄ (blr5625)	10-kDa chaperonin	6.53	5.87
groEL₄ (blr5626)	60-kDa chaperonin	6.83	5.39
groES₂ (blr6978)	Chaperonin	4.31	ND
groES₅ (bsr7532)	10-kDa chaperonin (protein CPN10)	4.13	3.78
groEL₅ (blr7533)	60-kDa chaperonin	3.08	2.50
Cell envelope
bll1204	Outer membrane immunogenic protein precursor	7.57	7.43
bll1766	Outer membrane protein	5.42	4.33
blr4700	Putative outer membrane immunogenic protein precursor	10.67	8.76
blr4701	Putative outer membrane immunogenic protein precursor	7.94	8.56
bll6888	Putative porin	7.52	9.13
bll7469	Putative outer membrane immunogenic protein precursor	6.92	7.21
Chemotaxis
ctpI (bll1434)	Pilus assembly protein	1.74	1.69
ctpG (bll1436)	Pilus assembly protein	1.63	1.67
ctpE (bll1438)	Pilus assembly protein	2.73	2.72
ctpD (bll1439)	Pilus assembly protein	1.79	1.89
ctpC (bll1440)	Pilus assembly protein	2.45	2.71
ctpA (bsl1442)	Pilus assembly protein pilin subunit	6.56	8.04
cheA (blr2192)	Chemotaxis two-component hybrid sensor and regulator	2.24	2.43
cheW (blr2193)	Probable purine-binding chemotaxis protein	2.19	2.18
cheY (blr2194)	Chemotaxis two-component response regulator	4.28	4.52
cheY (blr2342)	Chemotaxis two-component response regulator	1.98	2.44
pilA (bsl6587)	Components of type IV pilus pilin subunit	5.48	6.16
ctpA (bsl7141)	Components of type IV pilus pilin subunit	6.60	7.68
bll6865	Flagellin	2.38	2.31
bll6866	Flagellin	2.62	2.68
fliE (bll5812)	Flagellar hook basal body complex protein	2.15	2.31
flgC (bll5813)	Flagellar basal body rod protein	2.04	2.28
flgD (bll5814)	Probable flagellar basal body rod protein	1.97	2.10
fliL (bll5826)	Flagellar synthesis protein	2.81	2.52
fliX (bll5837)	Probable flagellar assembly protein	1.56	ND
fliN (blr7002)	Flagellar motor switch protein	2.11	2.28

↵ a Differentially expressed genes were selected based on a 1.5-fold cutoff.
↵ b C/H, chemoautotrophy (C) and heterotrophy (H) comparisons.
↵ c CA/H, a comparison of arabinose-supplemented chemoautotrophy (CA) and heterotrophy (H).
↵ d ND, not determined.

Additional Files

Figures
Tables

Supplemental material

Files in this Data Supplement:

Supplemental file 1 - Table S1, genes significantly induced in chemoautotrophic cultures.
Zipped MS Excel file, 39K.
Supplemental file 2 - Table S2, genes significantly repressed in chemoautotrophic cultures.
Zipped MS Excel file, 30K.
Supplemental file 3 - Table S3, genes significantly induced in arabinose-supplemented.
chemoautotrophic cultures.
Zipped MS Excel, 30K
Supplemental file 4 - Table S4, genes significantly repressed in arabinose-supplemented chemoautotrophic cultures.
Zipped MS Excel file, 27K.