Article Figures & Data
Figures
- FIG. 1.
Plasmids used in the study. Schematic diagrams of plasmids pSL102, pSL103, and pSL115 are shown (29). The genes encoding chloramphenicol acetyltransferase (cat) and β-lactamase (bla) are marked. The blaP and rrnGP2 promoters, the site of the rrn antitermination system insertion (AT), and the fragment containing a Rho-dependent terminator (ter) are also marked (29).
- FIG. 2.
Relative chloramphenicol resistance levels of the wild-type and ΔnusB strains containing the AT tester sequences in plasmid pSL103 derivatives (see Materials and Methods for details). P, promoter only (pSL102); P+T, promoter plus terminator (pSL103). All other strains have the indicated AT sequence inserted between the promoter and terminator. Identity of inserted AT sequences: Ec, E. coli; Bs, Bacillus subtilis; Cc, Caulobacter crescentus; Mj, Methanococcus jannaschii; Mt, Mycobacterium tuberculosis; Pa, Pseudomonas aeruginosa; Tm, Thermotoga maritima. Shown are triplicate experiments performed on separate days. The ΔnusB strains have a slower growth phenotype and thus display a lower level of chloramphenicol resistance when measured at the same time as the wild-type strains.
- FIG. 3.
Slot blot analysis of expression from the cat and bla genes. See Materials and Methods for experimental details. Duplicate samples were analyzed in this example. Abbreviations are the same as those used in Fig. 2.
- FIG. 4.
Alignment of the rrn AT regions of a sample of sequenced Gammaproteobacteria. Residues with more than 50% conservation at each position are shaded. Bars above the sequence denote the extent of the boxA and GT-rich boxC regions. The sequences are taken from published genomic data in the NCBI database.
Tables
- TABLE 1.
Strains and plasmids used in this study
Strain or plasmid Description Source or reference Strains MG1655 E. coli wild-type strain 6 SQ736 MG1655ΔnusB This work AP1 MG1655(pSL102) This work AP5 MG1655(pSL103) This work AP9 MG1655(pSL115) This work SZ46 MG1655ΔnusB(pSL102) This work SZ47-1 MG1655ΔnusB(pSL103) This work SZ48-1 MG1655ΔnusB(pSL115) This work STN1 MG1655(pAT-Bs) This work STN2 MG1655ΔnusB(pAT-Bs) This work STN3 MG1655(pAT-Cc) This work STN4 MG1655ΔnusB(pAT-Cc) This work STN5 MG1655(pAT-Mj) This work STN6 MG1655ΔnusB(pAT-Mj) This work STN9 MG1655(pAT-Mt) This work STN10 MG1655ΔnusB(pAT-Mt) This work STN11 MG1655(pAT-Pa) This work STN12 MG1655ΔnusB(pAT-Pa) This work STN15 MG1655(pAT-Tm) This work STN16 MG1655ΔnusB(pAT-Tm) This work Plasmids pSL102 29 pSL103 29 pSL115 29 pHBA17 Source of trpt′ terminator 1 pAT-Bs B. subtilis AT This work pAT-Cc C. crescentus AT This work pAT-Mj M. jannaschii control This work pAT-Mt M. tuberculosis AT This work pAT-Pa P. aeruginosa AT This work pAT-Tm T. maritima AT This work pAVC1 pAT-Cc minus 16S terminator This work pAVC2 pAVC1 plus trpt′ terminator This work pAVC3 pAVC1 minus rrnGP2 promoter This work pAVC4 pSL102 minus rrnGP2 promoter This work - TABLE 2.
Sequences of oligonucleotides used
Oligonucleotide Sequence (5′-3′)a nusBdel1F aatgtattgaaagccatcaaggcctgaaattagtaatgtgtaggctggagctgctt nusBdel1R catggaacggtcttccgtgaatctaccggcctggaagttcctattccgaagttc bla gggaataagggcgacacggaaatg cat tgccattgggatatatcaacggtgg Ec cgatcgccgctgagaaaaagcgaagcggcactgcTCTTTAACAAtttatcagacaatctgtgtgggcactcga Bs cgataataaagtcgcttaaacgagcggtaaacaaagtTCTTTGAAAActaaacaagacaaaacgtacctgttggatcc Cc cgatggggccgctgaggcggttcgggTCTTTGACATtgttgaattggaaagagaaacgcaggcggcggcgctctggcgatgggatcc Mt cgatgtcgccccgaagcgggcggaaacaagcaagcgTGTTTGAGAActcaatagtgtgtttggtggatcc Pa cgatcctcggttgagacgaaagccttgaccaactgcTCTTTAACAAgtcgaatcaagcaattcgtgtgggtggatcc Tm cgatcggcgacgttgagatgaagggTCTTCAGAAAgcggaaaaagaagaataaaacccggaaagagaagttggatc Mj cgattccggttgatcctgccggaggccactgctatcggggtccgactaagccatgcgagtcggatc ↵ a Sequences of synthetic oligonucleotides cloned to generate AT regions. The boxA sequence is capitalized. The identities of the cloned AT sequences are as follows: Ec, E. coli; Bs, Bacillus subtilis; Cc, Caulobacter crescentus; Mt, Mycobacterium tuberculosis; Pa, Pseudomonas aeruginosa; Tm, Thermatoga maritima; Mj, Methanococcus jannaschii. The final nucleotide in the Caulobacter crescentus boxA that differs from all of the other boxA sequences shown is indicated in bold (CAT instead of CAA). This conserved A at the end of boxA is one of the nucleotides that interacts with NusA (5).
- TABLE 3.
cat and bla mRNA quantitation resultsa
Description Sequence of boxA region % Readthrough Wild type (n = 5) ΔnusB (n = 6) P - - 100 100 P - Ter 2.1 ± 0.6 2.4 ± 0.3 P ATEcTer GCUCUUUAACAA 102.8 ± 12.8 1.8 ± 0.3 P ATBsTer GUUCUUUGAAAA 16.4 ± 1.2 2.6 ± 0.4 P ATCcTer GGUCUUUGACAU 7.5 ± 1.1 4.8 ± 1.4 P ATMjTer GGUCCGACTAAG 1.6 ± 0.3 1.4 ± 0.3 P ATMtTer GUUGUUUGAGAA 1.9 ± 0.3 1.8 ± 0.3 P ATPaTer GCUCUUUAACAA 77.5 ± 10.3 1.0 ± 0.0 P ATTmTer GGUCUUCAGAAA 3.2 ± 0.7 2.4 ± 0.7 λ phage CGCUCUUACACA ↵ a These analyses were repeated independently five to seven times with duplicate or triplicate samples analyzed each time. The λ phage boxA sequence is shown for comparison.
