GENETICS AND MOLECULAR BIOLOGY

Characterization of the Corynebacterium glutamicum ΔpimB′ ΔmgtA Double Deletion Mutant and the Role of Mycobacterium tuberculosis Orthologues Rv2188c and Rv0557 in Glycolipid Biosynthesis

Arun K. Mishra, Sarah Batt, Karin Krumbach, Lothar Eggeling, Gurdyal S. Besra
DOI: 10.1128/JB.01729-08

Article Figures & Data

Figures

  • FIG. 1.
    FIG. 1.

    Glycolipid biosynthetic pathways in Corynebacterineae. (A) PIM synthesis in M. tuberculosis; (B) PIMs; (C) ManGlcAGroAc2 synthesis in C. glutamicum.

  • FIG. 2.
    FIG. 2.

    Glycolipid profiles of C. glutamicum, C. glutamicum ΔpimB′, C. glutamicum ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA-pEKEx2-Rv2188c, and C. glutamicum ΔpimB′ ΔmgtA-pEKEx3-Rv0557. The polar lipid extracts were examined by 2D-TLC on aluminum-backed plates of silica gel 60 F254 (Merck 5554), using CHCl3/CH3OH/H2O (60:30:6, vol/vol/vol) in the first direction and CHCl3/CH3COOH/CH3OH/H2O (40:25:3:6, vol/vol/vol/vol) in the second direction. Glycolipids were visualized by spraying plates with α-naphthol/sulfuric acid, followed by gentle charring of the plates.

  • FIG. 3.
    FIG. 3.

    MALDI-TOF MS analyses of glycolipids from C. glutamicum, C. glutamicum ΔpimB′, C. glutamicum ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA-pEKEx2-Rv2188c, and C. glutamicum ΔpimB′ ΔmgtA-pEKEx3-Rv0557. (A) Negative-ion-mode MALDI-TOF MS analysis of total glycolipid extract from strains. The peaks observed are m/z 836 (M-H)− [PI with C16/C18:1 fatty acyl groups], m/z 998 (M-H)− [PIM1 with C16/C18:1 fatty acyl groups], m/z 1236 (M-H)− [Ac1PIM1with 2C16/C18:1 fatty acyl groups], and m/z 1,398 (M-H)− [Ac1PIM2 with 2C16/C18:1 fatty acyl groups]. The peak m/z 748 was not attributable to any PIM species and, as such, may represent unidentified lipid species and/or plasticizer. (B) Positive-ion MALDI-TOF MS spectrum of the cationized, sodiated precursor ion (M-H + 2Na)+ of GlcAGroAc2 and ManGlcAGroAc2 at m/z 815 and m/z 977, respectively.

  • FIG. 4.
    FIG. 4.

    Lipoglycan profiles of C. glutamicum, C. glutamicum ΔpimB′, C. glutamicum ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA-pEKEx2-Rv2188c, and C. glutamicum ΔpimB′ ΔmgtA-pEKEx3-Rv0557. Lipoglycans were analyzed using SDS-PAGE and visualized using a Pro-Q emerald glycoprotein stain (Invitrogen) specific for carbohydrates. The three major bands represented by LAMCg, LM-ACg, and LM-BCg (which comigrates with LM-ACg) are indicated. The CandyCane glycoprotein molecular weight standards (Invitrogen) are provided on the right for comparison. The four major bands represent glycoproteins of 180, 82, 42, and 18 kDa, respectively.

  • FIG. 5.
    FIG. 5.

    In vitro mannolipid biosynthesis. (A) Biosynthetic reaction scheme of products formed in in vitro assays utilizing GDP[14C]Man and corynebacterial membranes. (B) TLC-autoradiography of synthesized mannolipids, using GDP[14C]Man and membrane extracts from C. glutamicum, C. glutamicum ΔpimB′, C. glutamicum ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA, C. glutamicum ΔpimB′ ΔmgtA-pEKEx2-Rv2188c, and C. glutamicum ΔpimB′ ΔmgtA-pEKEx3-Rv0557. Enzymatically synthesized products PP[14C]M, [14C]ManGlcAGroAc2, Ac1PI[14C]M2, and PI[14C]M1 were isolated and subjected to TLC/autoradiography using CHCl3/CH3OH/NH4OH/H2O (65:25:0.4:3.6, vol/vol/vol/vol).

  • FIG. 6.
    FIG. 6.

    Mannolipid synthesis using recombinant PimB′Cg. (A) Recombinant PimB′Cg was purified using Ni2+-affinity chromatography and purity determined on a 12% SDS-PAGE gel. (B) TLC-autoradiography of synthesized mannolipids, using GDP[14C]Man and lipid extracts from C. glutamicum ΔpimB′ ΔmgtA (lane 1) and purified Ac1PIM1 (lane 2) with purified PimB′Cg. Enzymatically synthesized products were isolated and subjected to TLC/autoradiography using CHCl3/CH3OH/NH4OH/H2O (65:25:0.4:3.6, vol/vol/vol/vol).

  • FIG. 7.
    FIG. 7.

    Revised PIM and LAM biosynthetic pathway in M. tuberculosis.

Tables

  • TABLE 1.

    Strains, plasmids, and oligonucleotides used in this study

    Strain, plasmid, or oligonucleotideaRelevant characteristics or sequenceaSource, reference, or purpose
    C. glutamicum strains
        ATCC 13032Wild typeCulture collection
        C. glutamicum ΔmgtA C. glutamicum devoid of mgtACg 25
        C. glutamicum ΔpimB′ C. glutamicum devoid of pimB′ Cg 16
        C. glutamicum ΔpimB′ΔmgtA C. glutamicum devoid of pimB′ Cg and mgtACg This work
    Plasmids
        pK19mobsacBΔmgtA Vector enabling deletion of 1,094 bp of mgtACg 25
        pEKEx3-Rv0557 Expression of Rv0557 25
        pEKEx2-Rv2188c Expression of Rv2188c 16
        pET16bExpression vector, His-tag fusionNovagen
        pET16b-Cg-pimB′Expression of His-PimB′ Cg This work
    Primers
        Cg-pimB′forprot CTCCATATGTCTGCATCCCGAAAAACTCTCGTTGExpression of His6-PimB′ Cg (NdeI)b
        Cg-pimB′revprot GAGCATATGTTATCGTGGTTCACTCTGCAAAA TATTGExpression of His6-PimB′ Cg (NdeI)c

    • ↵ a Primers are given in their 5′ to 3′ direction.

    • ↵ b The linker endonuclease restriction site in the previous column is italicized.

    • ↵ c The restriction endonuclease restriction site in the previous column is italicized.

Back to top
Download PDF
Citation Tools
Print

Alerts
Email

KEYWORDS

Adenosine Triphosphatases
Bacterial Proteins
Corynebacterium glutamicum
Glycolipids
Mannosyltransferases
Membrane Transport Proteins

Related Articles

Cited By...