Article Figures & Data
Figures
- FIG. 1.
Effect of peptide and/or MMC on chromosome copy numbers of rpe and sulA (A) and viability (B) of treated Salmonella cultures. The wild-type LT2 and LT2 lacking resident prophages were compared to assess the potential contribution of prophage induction to the observed copy number and viability changes. As described in the text, qPCRs were done with a constant 5 μg of isolated genomic DNA.
- FIG. 2.
Peptide wrwycr inhibits excision of Salmonella prophage. (A) Chloroform lysates of LT2 P22 lysogen cultures treated with MMC, peptide, or both (as indicated on the left). (B) Chloroform lysates of wild-type LT2 cultures treated with MMC or peptide (as indicated). Lysates were serially diluted 10-fold and plated onto a lawn of MA8508, an LT2-derived strain cured of three of its four naturally occurring prophages and deleted for a large fraction of the fourth prophage (Gifsy-1, Gifsy-2, Fels-1, and Fels-2). Two microliters of each lysate, either undiluted or subsequent 10-fold dilutions, was spotted onto the bacterial lawns. These plates are representative of four to eight independent induction experiments.
- FIG. 3.
Trapping of phage lambda excisive recombination junction intermediates inside E. coli. The left side of the figure shows the structure of plasmid pLR110 and the orientation of the attL and attR sites. The right panel displays the results of a Southern analysis of plasmid DNA isolated from cells in which Int and Xis expression was induced or not, which were treated with the indicated amounts of peptide wrwyrggrywrw. The probe used was a 496-bp fragment encoding attL from pHN872 (32). The position of the markers for recombination substrate and product fragments and HJs is based on a parallel in vitro reaction. prod, products; rec, recombination; MW, molecular weight; +, present; −, absent.
Tables
- TABLE 1.
Bacterial strains used in this study
Strain designationa Species and strain Genotype/description Source G255 S. enterica serovar Typhimurium LT2 Wild type Lab collection RW138/G478 E. coli K-12 recA galK lacZ(ochre) Spcr (λ cIts857 λ dgal-138 cIts857) R. Weisberg MA8507/G754 S. enterica serovar Typhimurium LT2 Gifsy-1− Gifsy-2− Fels-2− L. Bossi MA8508/G755 S. enterica serovar Typhimurium LT2 Gifsy-1− Gifsy-2− Fels-2− Fels-1Δ(int-attR)::Camr L. Bossi G889 E. coli K-12 N99 λ cIts857 virr J. Gardner SDT2679 S. enterica serovar Typhimurium LT2 ΔFels-1::(frt::Kanr::frt) Lab collection SDT2739 S. enterica serovar Typhimurium LT2 MA8507 (Gifsy-1− Gifsy-2− Fels-2−) ΔFels-1::frt Lab collection SDT2704 S. enterica serovar Typhimurium LT2 P22 lysogen Lab collection N6377/G158 E. coli K-12 C600 thr leu thi pro gal + (chlD-pgl)Δ8/λ int + xis + Δ(SalI-XhoI) cI857 (cro-chl(A))ΔH1 A. Oppenheim via H. Nash EDT1084 E. coli K-12 N6377/pLR110 This study ↵ a The Segall lab strain designation is given after the strain designation from the lab of origin.
- TABLE 2.
Primers used to detect Salmonella prophage attachment sites via qPCRa
Oligonucleotide Sequence (5′ to 3′) Product Fels-1 attL up GCAGATTGAGTACACGCAGC Fels-1 attL Fels-1 attL down TTCTGCGAAAGGTACTATCTGCG Fels-1 attR up ATTGGCCGGAACAACCAG Fels-1 attR Fels-1 attR down-2 GTGTAGCTTCACGCTGGC Gifsy-1 attL up TCCATCGAATCAAGTACCTGAGC Gifsy-1 attL Gifsy-1 attL down GTGGAATGTCCACCGCTG Gifsy-1 attR up TTGCGGGGATCTTGAGAGG Gifsy-1 attR Gifsy-1 attR down GTAGTGTAGAATGCGGCGTTTC Gifsy-2 attL up CCGCTGGAGTATACCTTGTTTAGC Gifsy-2 attL Gifsy-2 attL down GTGGGATGTCAGAGAAGAGCG Gifsy-2 attR up GGTCTGTGAAGTTCGTTAAAGTTCG Gifsy-2 attR Gifsy-2 attR down CAAATCGCGCTACGCAGAATG sulA up CCTACCTTCGCTGCTTCAAC sulA sulA down CAGTCTTCAGGTTTGCCATT rpe for CCAGCTCACTGCGCATTTCA rpe rpe rev CCGCATTGATGCGTCCGGTT ↵ a The attB sites of any of the phages can be amplified using the appropriate combination of attL up and attR down primers specific for that phage (up signifies upstream and down signifies downstream). Similarly, the attP sites can be amplified by using the appropriate combination of attR up and attL down primers.
- TABLE 3.
Effect of peptide treatment on survival and phage production by a lambda lysogen
Treatment (concn) % Survival ± SD (no. of independent colonies) Phage titer (no. of colonies tested) Fraction of phagea DMSO (0.29%) 59.4 ± 7.7 (9) 8.9 × 109 (4) 1 wrwycr (24 μM) 69.1 ± 8.5 (15) 1.7 × 109 (4) 0.18 wrwyrggrywrw (12 μM) 70.7 ± 6.3 (6) 1.2 × 109 (4) 0.14 wrwyar (24 μM) 58.5 ± 5.7 (12) 8.3 × 109 (3) 0.9 ↵ a Fraction of phages whose titers were determined in lysates from bacteria treated with peptides relative to those whose titers were determined in lysates from bacteria treated with DMSO.
- TABLE 4.
Fold change in att site copy number after treatment with 1 μg ml−1 MMC and/or 32 μM peptide wrwycr or WRWYCAa
Prophage Site Fold change in copy no. with MMC or peptide treatment Fold inhibition of MMC-induced replication or excision MMC/DMSO wrwycr/DMSO WRWYCA/DMSO MMC/MMC + wrwycr MMC/MMC + WRWYCA Gifsy-1 attR 1.2 0.9 3.1 1.1 1.8 attB 102 0.1 2.7 316 29 Gifsy-2 attR 2.5 0.8 3.5 2.0 3.5 attB 266 0.2 4.2 242 7.7 Fels-1 attL 11 1.2 3.4 6.9 4.0 attB 24 3.6 1.3 3.5 0.4 Fels-2 attR 1.5 1.2 7.3 0.5 0.1 attB 107 5 18 5.6 0.4 ↵ a The data represent the averages of the results for at least two independent experiments, each experiment with two independent colonies.
