GENETICS AND MOLECULAR BIOLOGY

A DNase Encoded by Integrated Element CJIE1 Inhibits Natural Transformation of Campylobacter jejuni

Esther J. Gaasbeek, Jaap A. Wagenaar, Magalie R. Guilhabert, Marc M. S. M. Wösten, Jos P. M. van Putten, Linda van der Graaf-van Bloois, Craig T. Parker, Fimme J. van der Wal
DOI: 10.1128/JB.01430-08

Article Figures & Data

Figures

  • FIG. 1.
    FIG. 1.

    Comparison of C. jejuni strains by cluster analysis of comparative genomic indexing results. The genes are presented in the order of their positions on the genome of C. jejuni NCTC 11168 and are followed by the genes of C. jejuni RM1221 that are absent from C. jejuni NCTC 11168. For frames of reference, the lipooligosaccharide biosynthesis locus (Cj1136-Cj1144c) and the capsular biosynthesis locus (Cj1415c-Cj1442c) from C. jejuni NCTC 11168 are indicated. The Mu-like prophage insertion element (CJIE1) from C. jejuni RM1221 is also indicated. The gene status is color coded as follows: blue, present; yellow, variable or unknown; red, absent; gray, no data. For cutoffs for absence and presence predictions, see Materials and Methods. An average linkage hierarchical clustering of the C. jejuni strains was compiled in GeneSpring, version 7.3, from the comparative genome hybridization data for each element with the standard correlation and bootstrapping. A scale for distance scores is on the right.

  • FIG. 2.
    FIG. 2.

    Determination of the DNase activity of a C. jejuni dns knockout mutant (C356dns::cat) and a Dns expression construct [CNET002(pWM1007Pr1492dns)]. Phage lambda DNA (500 ng) was incubated (1 h, 37°C) with fractions isolated from C. jejuni and analyzed by agarose gel electrophoresis. Lane 1, nonnaturally transformable dns-positive strain C356; lane 2, dns knockout strain C356dns::cat; lane 3, naturally transformable strain CNET002; lane 4, CNET002 with Dns expression construct [CNET002(pWM1007Pr1492dns)]; lane 5, CNET002 containing the empty expression plasmid [CNET002(pWM1007Pr1492)]; lane +, positive control (DNA treated with 1 μg DNase I); lane −, negative control (mock-treated DNA).

  • FIG. 3.
    FIG. 3.

    Determination of the DNase activity of naturally transformable C. jejuni strains and dns-positive nonnaturally transformable strains. DNase activity was assayed as described in the legend to Fig. 2. Fractions were isolated from naturally transformable C. jejuni strains C013199, C011338, C019168, C013500, and GB18 (lanes 1 to 5, respectively) and from dns-positive nonnaturally transformable C. jejuni strains C011300, C019165, C012446, C012599, CCUG10950, 21.97, 233.95, 260.94, 308.95, and 386.95 (lanes 6 to 15, respectively). Lane +, positive control (DNA treated with 1 μg DNase I); lane −, negative control (mock-treated DNA).

  • FIG. 4.
    FIG. 4.

    Determination of the DNase activity of nonnaturally transformable dns-negative C. jejuni strains. DNase activity was assayed as described in the legend to Fig. 2. The nonnaturally transformable dns-negative strains tested were C017289, C011672, D3141, D3226, D3468, CNET007, 07479, 12795850312, and CNET005 (lanes 1 to 9, respectively). Lane +, positive control (DNA treated with 1 μg DNase I); lane −, negative control (mock-treated DNA).

Tables

  • TABLE 1.

    Bacterial strains used in this study

    StrainPenner serotypeGenotypeNatural transformabilityaSource or reference
    C. jejuni wild-type strains
        C019165HS:1NontransformableJ. A. Frost
        C013199HS:1TransformableJ. A. Frost
        C011338HS:1TransformableJ. A. Frost
        C017289HS:1NontransformableJ. A. Frost
        C011672HS:1NontransformableJ. A. Frost
        C019168HS:1transformableJ. A. Frost
        C011300HS:1NontransformableJ. A. Frost
        C013500HS:2TransformableJ. A. Frost
        C356 (CNET076)HS:2NontransformableW. F. Jacobs-Reitsma
        C012599HS:2NontransformableJ. A. Frost
        5003 (CNET002)HS:2TransformableS. L. On
        C012446HS:2NontransformableJ. A. Frost
        D3468HS:19Nontransformable 31
        D3141HS:19Nontransformable 31
        CCUG10950HS:19NontransformableCulture Collection, University of Göteborg, Göteborg, Sweden
        GB18HS:19Transformable 13
        D3226HS:19Nontransformable 31
        233.95HS:41Nontransformable 48
        308.95HS:41NontransformableA. J. Lastovica
        21.97HS:41NontransformableA. J. Lastovica
        386.96HS:41Nontransformable 48
        260.94HS:41Nontransformable 48
        41239B (CNET005)HS:55Nontransformable 20
        07479HS:55Nontransformable 20
        12795850312HS:55NontransformableD. L. Baggesen
        40707L (CNET007)HS:55Nontransformable 20
        NCTC 11168-OHS:2Transformable 17
        RM1221HS:53Nontransformable 30
    C. jejuni mutant strain and transformants
        C356dns::cat This study
        CNET002(pWM1007Pr1492dns)This study
        CNET002(pWM1007Pr1492)This study
    E. coli strains
        DH5αF− φ80dlacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk− mk +) phoA supE44 λ− thi-1 gyrA96 relA1 Invitrogen, Breda, The Netherlands
        K12 ER2925 ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 R(zgb210::Tn10)Tets endA1 rpsL136 dam13::Tn9 xylA-5 mtl-1 thi-1 mcrB1 hsdR2 NEB, Ipswich, MA

    • ↵ a The lowest level of detection for the natural transformation frequency is 10−10. For natural transformation frequencies see Table S1 in the supplemental material.

  • TABLE 2.

    Primers and plasmids used in this study

    Primer or plasmidSequence (5′-3′) or relevant characteristicsaSource or reference
    Primers
        dns-FATGAAAAAAATAATAAGCGTTTTAATAC
        dns-RTTAGAGTAATGCTCTAATTCTTTTTTC
        dnsSacIICATATG CCGCGG GGCTCCTACTAATTTAAAATATAC
        dnsMfeIGTCGACCAATTGTCAGCATATCTAAAATTGCTTCTATC
        catSacIICATATGCCGCGGCACAACGCCGGAAACAAG
        catMfeIGTCGAC CAATTG CCGCAGGACGCACTACTCT
        dnscontr-FCTTTTAAGATTTCTCGTTTGTCG
        dnscontr-RCAAGCCTTGAAATAATGCATAATG
        dnsexpr-FAGATCTTCTAGATAAAAAATAAAAAGGAGAATAAATG
        dnsexpr-RCCATGGCAATTGTTAGAGTAATGCTCTAATTC
        Pr1492MfeIACTAGT CAATTG GCGATGGCCCTG
        Pr1492XbaIAGATCT TCTAGA CTCATTTAACGGTTGTCTCC
    Plasmids
        pCR2.1TA cloning vector, Ampr Invitrogen
        pdns pCR2.1 containing the dns gene of C. jejuni strain RM1221This study
        pUOA23 E. coli-C. jejuni shuttle vector containing the cat gene of C. coli, Cmr
        pdns::cat pdns with cat inserted in dns, Cmr This study
        pWM1007Pr1492 C. jejuni expression plasmid containing the Cj1492 promoter, Kmr 52
        pWM1007Pr1492dns C. jejuni expression plasmid with dns This study
        pUOA13 E. coli-C. jejuni shuttle vector, Kmr 46

    • ↵ a The endonuclease restriction sites introduced into the sequences are underlined.

  • TABLE 3.

    C. jejuni natural competence and transformation genes

    Locus tagGeneProteinReference
    Cj0011cPutative nonspecific DNA binding protein 23
    Cj0634 dprA SMF family protein 43
    Cj0825Putative processing peptidase 51
    Cj1028cPossible purine/pyrimidine phosphoribosyltransferase (ctsW) 51
    Cj1076 proC Pyrroline-5-carboxylate reductase 51
    Cj1077 ctsT Putative periplasmic protein 51
    Cj1131c galE UDP-glucose 4-epimerase 16
    Cj1343cPutative periplasmic protein (ctsG) 51
    Cj1352 ceuB Enterochelin uptake permease 51
    Cj1470cPseudogene (type II protein secretion system F protein) (ctsF) 51
    Cj1471c ctsE Putative type II protein secretion system E protein 51
    Cj1472cHypothetical protein (ctsX) 51
    Cj1473c ctsP Putative ATP/GTP-binding protein 51
    Cj1474c ctsD Putative type II protein secretion system D protein 51
    Cj1475c ctsR Hypothetical protein 51
  • TABLE 4.

    Genes absent in at least 67% of the naturally transformable C. jejuni strains and present in the majority (≥55%) of nonnaturally transformable strains

    RegionLocus tagProductLocusPresence in C. jejuni strains
    Naturally transformable Nonnaturally transformable
    Penner serotype HS:1 Penner serotype HS:2 Penner serotype HS:19 Penner serotype HS:1 Penner serotype HS:2 Penner serotype HS:19 Penner serotype HS:41 Penner serotype HS:55
    C013199C011338C019168C0135005003 (CNET002)GB18C011300C017289C019165C011672C012446C012599C356 (CNET076)D3141D3226CCUG10950D346821.97233.95260.94308.95386.9640707L (CNET007)074791279585031241239B (CNET005)
    CJIE1a CJE0215Phage repressor protein, putative−+−−−++−+−++++++++++++++++
    CJE0220Adenine-specific DNA methyltransferase dam −+−−−++−+−++++++++++++−−−−
    CJE0221Phage virion morphogenesis protein, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0226Phage-related tail protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0227Tail sheath protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0228Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0230Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0231Putative phage tail fiber protein H−+−−−−+−+−+++−−+−+++++−−−−
    CJE0232Putative phage tail protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0233Baseplate assembly protein J, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0234Baseplate assembly protein W, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0236Baseplate assembly protein V, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0237Conserved hypothetical protein−+−−−−+−+−+++−−+−+++++−+−−
    CJE0241Conserved hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0243Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0244Mu-like prophage I protein, putative−+−−−−+−+−+++−−+−+++++−+−−
    CJE0245Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0246Conserved hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0247Conserved domain protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0248Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0249Phage uncharacterized protein, C-terminal domain, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0250Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0252Putative tail-related phage protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0254Tail protein D, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0256Extracellular DNase dns −+−−−−+−+−+++−−+−+++++−−−−
    CJE0257Conserved domain protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0258Conserved domain protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0259Hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0261Hypothetical protein−+−−−−+−+−+++−−+−+++++−+−−
    CJE0265Host nuclease inhibitor protein Gam, putative−+−−−−+−+−+++−−+−+++++−−−−
    CJE0266Conserved hypothetical protein−+−−−−+−+−+++−−+−+++++−−−−
    CJE0269Bacteriophage DNA transposition protein B, putative−+−−−−+−+−+++−−+−+++++−−−−
    Variable region 17b CJE0310Adenine-specific DNA methyltransferase−+−−−−+−+−+++−−+−+++++−−−−
    Variable region 14c CJE17254-Carboxymuconolactone decarboxylase, putative−−+−−++−+−−−−+++++++++++++
    CJE1727Conserved hypothetical protein−−+−−++−+−−−−+++++++++++++
    CJE1728Transporter, putative−−+−−++−+−−−−+++++++++++++
    Variable region 13d Cj1442c−−−++−−−+−++++−−−+++++++++

    • ↵ a CJIE1/CMLP1 (CJE0213 to CJE0273) (15).

    • ↵ b Cj0258 to Cj0263 and CJE0308 to CJE0313 (35).

    • ↵ c Cj1543c to Cj1563c and CJE1714 to CJE1734 (restriction-modification locus) (35).

    • ↵ d Cj1414c to Cj1449c and CJE1601 to CJE1622 (capsular locus) (35).

  • TABLE 5.

    Effect of Dns on natural transformation frequencies of C. jejuni

    StrainaNatural transformation frequencyb
    C356−
    C356dns::cat (2.4 ± 0.6) × 10−06 c
    CNET002(2.5 ± 0.2) × 10−05
    CNET002(pWM1007Pr1492)(2.7 ± 1.4) × 10−05
    CNET002(pWM1007Pr1492dns)(2.1 ± 1.8) × 10−08 c

    • ↵ a To determine the natural transformation frequency of C. jejuni strains C356 and C356dns::cat, homologous pUOA13 plasmid DNA (kanamycin resistance marker) was used; for strains CNET002, CNET002(pWM1007Pr1492), and CNET002(pWM1007Pr1492dns) homologous chromosomal DNA was used (chloramphenicol resistance marker).

    • ↵ b The natural transformation frequency was determined by dividing the number of transformants ml−1 by the total number of CFU per ml−1. The values are the averages of three experiments. −, below the detection limit (5.6 × 10−10 ± 5.0 × 10−10), which is based on a minimum of one colony per plate, adapted to the volumes used in the procedure.

    • ↵ c P < 0.05 (Student's t test) for a comparison with the corresponding parental strain.

Additional Files

  • Supplemental material

    Files in this Data Supplement:

    • Supplemental file 1 - Table S1, natural transformability of C. jejuni Penner serotypes HS:1 and HS:2.
      PDF file, 9K.
    • Supplemental file 2 - Table S2, genes present in the majority of naturally transformable C. jejuni strains and absent in at least 50% of non-naturally transformable C. jejuni strains.
      PDF file, 22K.
Back to top
Download PDF
Citation Tools
Print

Alerts
Email

KEYWORDS

Bacterial Proteins
Campylobacter jejuni
DNA Transposable Elements
Deoxyribonucleases
Transformation, Bacterial

Related Articles

Cited By...