Article Figures & Data
Figures
- FIG. 1.
Organization of the type 3 fimbrial gene cluster. The transcriptional polarity of the mrk genes is indicated by the arrowheads. The mrkA promoter (PmrkA) has previously been mapped, and the location of the PmrkJ and PmrkH promoters is based upon nucleotide sequence analysis.
- FIG. 2.
Phosphodiesterase activity of MrkJ. (A) Swarming phenotypes of V. parahaemolyticus strains LM5674 and LM6567 (ΔscrABC) transformed with the vector control compared to LM6567 transformed with a plasmid expressing intact MrkJ. (B) In vitro phosphodiesterase activity assays comparing the ability of partially purified MrkH and MrkJ to cleave the phosphodiesterase-specific substrate bis(pNPP). Release of p-nitrophenol was determined at 410 nm (***, P < 0.001). Statistically significant differences were determined by using a Student t test.
- FIG. 3.
Biofilm formation phenotypes of K. pneumoniae strains. (A) Biofilm formation of K. pneumoniae strains IApc35 and IApc35 ΔmrkJ (****, P < 0.0001). (B) Comparison of K. pneumoniae strains IApc35 and IApc35ΔmrkJ transformed with the empty vector control (VC) to IApc35ΔmrkJ complemented with cloned mrkJ (**, P < 0.01; ***, P < 0.001). Statistically significant differences were determined by using a Student t test.
- FIG. 4.
Single transcriptional unit of the mrk gene cluster. RT-PCR analysis of the intergenic regions of the mrkABCDF operon was performed using primers described in the text to detect mRNA at these regions. The location of the transcripts are indicated by the numbered lines. Electrophoretic analysis was performed on reaction mixtures possessing (+) or lacking (−) reverse transcriptase (RT). The sizes of the cDNA amplicons were predicted from the locations of the primers used.
- FIG. 5.
Analysis of fimbrial expression in strains IApc35 and IApc35ΔmrkJ. (A) Cell suspension immunoblots with MrkA specific antibody. Numbers represent the CFU bound to the nitrocellulose membrane. (B) qRT-PCR analysis of mrkA transcript levels in Klebsiella strains IApc35 and IApc35ΔmrkJ (**, P < 0.01). Statistically significant differences were determined by using a Student t test.
Tables
- TABLE 1.
Strains, primers, and oligonucleotides used in this study
Strain, plasmid, or oligonucleotide Description or sequence (5′-3′)a Source or reference Strains IApc35 Plasmid cured variant of IA565, type 3 fimbriae+ 21 IApc35ΔmrkJ IApc35 mrkJ deletion mutant, highly type 3 fimbriate This study LM5674 ΔopaR V. parahaemolyticus 14 LM6567 ΔscrABC mutant of LM5674 14 S17-1λpir E. coli donor strain 6 SM10λpir E. coli donor strain 6 Plasmids pACYC184 Tetr Camr cloning vector w/p15A ori ATCC, Manassas, VA pDS132 Camr sacB suicide vector 36 pDEST17 Ampr Gateway compatible His6 tag expression vector Invitrogen, Carlsbad, CA pENTR-D-Topo Kanr Gateway entry vector Invitrogen, Carlsbad, CA pGEM-T Easy Ampr subcloning vector Promega, Madison, WI pACYCmrkJ Tetr Cams pACYC184-derived vector with mrkJ inserted at EcoRI-ScaI This study LM2449 Genr broad-host-range vector carrying IPTG-inducible scrC 14 LM2796 Genr broad-host-range vector carrying IPTG-inducible scrABC 14 Oligonucleotides JGJ80 CATGTCCAGCATCACCGTTG JGJ81 CAAGGAGATCGGCGTTGTCG JGJ82 CGACTGCCGACAATAAAGCC JGJ83 ACGGCGGTAAAGCCCTGAACA JGJ122 CCTGTTCACCTATTACGTTGGC JGJ132 CCGGTAAATCAGTAGCGGAT JGJ135 CTGCTGCTGTCTACTGACAAC JGJ136 CTTAATACGCAGCGTCTGGC JGJ137 CTACATCACCATACCGCTGC JGJ138 AGGGTAAACGGCTGCGGTTTC JGJ143 TCTAGACGTAGCGTACAGCGATATCA JGJ144 GCGGCCGCCACCCTGGATAACGCTA JGJ145 TCTAGAGGGAATGGAGTGGTTTGCTA JGJ146 GCGGCCGCGTACCCTTGCCACAAGC rpoDqRT-PCRF CTGACGCGCGACACCAT rpoDqRT-PCRR GAACGCGATCCATCATGCT mrkJGateway-F CACCATGAACACTAAAATATTCGAAG mrkJGateway-R TTACATGGCAATATCATCGGC mrkAqRT-PCRF GAACTGGACCGGCGGTAA mrkAqRT-PCRR TCACCCGGGATGATTTTGTT ↵ a Camr, chloramphenicol resistance; Genr, gentamicin resistance; Tetr, tetracycline resistance; Ampr, ampicillin resistance; Kanr, kanamycin resistance.
- TABLE 2.
Type 3 fimbria production and intracellular c-di-GMP concentrations
K. pneumoniae strain(plasmid) c-di-GMPa Titer with fimbria-specific serum IApc35 Normal 5,120 IApc35(LM2449)-IPTG Normal/High 10,240 IApc35(LM2449) +IPTG High 40,960 IApc35(LM2796)-IPTG Normal/Low <40 IApc35(LM2796) +IPTG Low <40 IApc35(pACYC184ΔCmr) Normal 5,120 IApc35(pACYCmrkJ) Low <40 ↵ a Predicted concentrations of intracellular c-di-GMP.
