Emergence of Pseudomonas aeruginosa Strains Producing High Levels of Persister Cells in Patients with Cystic Fibrosis

Bacterial strains, media, and growth conditions.The P. aeruginosa strains used in this study are described in Table 1. E. coli DH5α was used as a recipient for all cloning procedures, and E. coli HB101 harboring plasmid pRK2013 was used in triparental matings to mobilize constructs into P. aeruginosa (43). For routine maintenance and subculturing, cells were grown in LB medium. For killing experiments and MIC determination, cells were grown in Mueller-Hinton broth (MHB). The MIC was determined according to CLSI recommendations (7). The ofloxacin MIC of persister progeny was determined by recovering surviving persisters after 8 h of ofloxacin treatment (50× MIC), washing cells, and allowing surviving persisters to regrow in fresh medium to the stationary phase. These cells, the progeny of surviving persisters, were used in a new MIC test.

Biofilms were grown by the hanging-peg model (5). The device used for biofilm formation in this study is a platform carrying 96 polystyrene pegs (Nunc no. 445497) with a peg hanging into each microtiter plate well (Nunc no. 269787). For biofilm formation, the device was placed in its original sterile tray filled with MHB and cells (10⁴/ml) and incubated for 24 h at 37°C on a tilting shaker that provides a shearing force. After biofilms were formed on the pegs, they were washed in MHB and the device with intact biofilms was placed in a microtiter plate with fresh MHB for drug susceptibility testing. Following an 8-h incubation in the presence of an antimicrobial agent, the pegs were washed twice in MHB and the device was placed in a microtiter plate with MHB and incubated for 10 min in a water bath sonicator (Branson Ultrasonic Cleaner; Branson Cleaning Equipment Company). For each antimicrobial concentration tested, cells were collected from four parallel pegs and plated for colony counting.

Construction of strains and plasmids.To construct the ΔmexXY strain, approximately 800-bp fragments upstream and downstream of mexXY were PCR amplified and used in an overlap extension reaction to create a single 1,600-bp product. The following primers were used: upstream primers oLM007 (5′ CCCAAGCTTTTCTCCCTGGGCAGTGCAAACAAGCGCAAC 3′) and oLM008 (5′ ATCGAGGGACACCCATGTGATGCCCCTAGCGAAACTCTCG 3′) and downstream primers oLM009 (5′ GTTTCGCTAGGGGCATCACATGGGTGTCCCTCGATTCG 3′) and oLM010 (5′ ATGCTCTAGATTGCCCCTGCTTCTCGAGCAGCTC 3′).

This product was cloned into plasmid pEX18Gm (25), using XbaI and HindIII sites, which was then transformed into DH5α. The plasmid was transferred into a recipient strain (the 96-month isolate from the index patient) by triparental mating that included the donor strain DH5α conjugation with strain HB101 and the helper HB101, followed by selection and screening for P. aeruignosa transconjugants with the deletion as previously described (43). Deletion of the mexXY genes was verified by PCR.

Persistence assay.Persistence was measured by determining survival upon exposure to antibiotics. Time- or dose-dependent killing produces a distinct biphasic pattern with a plateau of surviving persisters (28). The concentration of antibiotics used was therefore within the persister plateau. To determine the number of persisters in the stationary phase, 3 ml of cell culture was incubated in a 10-ml culture tube with aeration for 16 h overnight in MHB medium. The cultures were exposed to ofloxacin for at least 8 h, and samples of cells were removed prior to and after ofloxacin exposure. Samples were washed, serially diluted, spot plated on MHB agar plates, and grown for at least 48 h before CFU determination.

Drug tolerance of longitudinal isolates from a single patient.We previously reported that killing of P. aeruginosa PAO1 is biphasic, indicating the presence of drug-tolerant persister cells (48). In order to examine drug tolerance in a clinical isolate, a dose-dependent killing experiment was performed with an early isolate from a single CF patient (Fig. 1). Persisters are most abundant at the stationary state, and after overnight growth in rich medium, cells were exposed to increasing concentrations of ofloxacin. Testing in the stationary state provides an additional advantage of eliminating the differences in drug tolerance due to possible variation in growth rates among different isolates. The bulk of the population was effectively killed with 5 μg/ml ofloxacin, the maximal concentration achieved in the human plasma (22). A small fraction of 10⁻⁴ to 10⁻³% of cells were tolerant to 100 μg/ml ofloxacin (200× MIC), represented by the typical persister plateau in the biphasic killing plot. Applying an antibiotic at a concentration within the plateau followed by plating and counting colonies directly measures the amount of persisters formed. This approach was used to determine the level of persister cells in the clinical isolates examined in this study.

• Open in new tab
• Download powerpoint

FIG. 1.

Dose-dependent killing of a clinical isolate of P. aeruginosa. Strain AMT0023-30 was isolated from an 8-month-old patient. Antibiotic was added at time zero at the indicated concentration to a stationary-phase culture, and after an 8-h incubation, surviving persister cells were plated for colony count (percent survival ± standard error of the mean [SEM]; n = 3).

In order to test if hip mutants are selected in the course of a chronic CF infection, we examined a set of longitudinal isolates of P. aeruginosa from a single patient collected between the ages of 8 and 96 months. The set comprises 35 strains, and the genomes of the first and last isolates (AMT0023-30 and AMT0023-34, respectively) were sequenced (47). The 96-month isolate has 68 unique mutations, as compared to the first isolate. PCR amplification and sequencing of the putative mutant regions in the remaining 33 isolates showed that many of them were shared among the strains, and there was a progressive accumulation of genetic changes (Fig. 2A) (47). This showed that the infection was caused by a clonal expansion of the early isolate with potentially several lineages coevolving into a dominant infecting clone. Between months 60 and 92, a mutS mutation appeared, conferring a hypermutator phenotype on the clonal lineage (39), and there was a concomitant sharp increase in the number of mutations, from 26 to 68 in the last four isolates.

• Open in new tab
• Download powerpoint

FIG. 2.

Persister levels in longitudinal clonal isolates of P. aeruginosa from a CF patient. (A) The number of mutations at the time a given strain was isolated (47); (B) persister levels (percent survival ± SEM; n = 3) of 35 longitudinal isolates of P. aeruginosa. Stationary-phase cultures were exposed to 100 μg/ml of ofloxacin for 8 h, and surviving cells were determined by colony count. hip mutants are indicated with black bars. (C) Persister progeny from the 96-month hip mutant form the same levels of persisters. The 96-month isolate was grown to the stationary phase and treated with 100× the MIC of ofloxacin for 8 h, and persister levels were determined (96-month isolate persisters). Persisters were regrown to the stationary phase (progeny of 96-month isolate persisters) and then treated with 100× the MIC of ofloxacin for 8 h, after which persister levels were determined were determined by colony count (persisters of progeny) (log [CFU/ml] ± SEM; n = 3).

The 35 isolates from the patient were cultured in MHB medium overnight, and the level of surviving persisters was determined after an 8-h incubation with ofloxacin added at 100 μg/ml. The persister level varied among the strains, but there was a dramatic, approximately 100-fold increase in surviving cells in the four late isolates, approaching 1% of the total population (Fig. 2B). This increase in persister formation suggested that the late isolates are hip mutants. One potential concern with this assay is that the late isolates, including the 96-month isolate, are hypermutators, and the hip mutants could be formed and selected for in the course of the experiment, rather than during evolution of these strains in the patient. To distinguish between these two possibilities, we tested the progeny of persisters from the 96-month isolate for their ability to form persisters. After treatement for 8 h with 100× MIC of ofloxacin, the surviving persister cells of the 96-month isolate were allowed to regrow to stationary phase in fresh medium, and subjected to a second round of killing with 100× the MIC of ofloxacin. Persister levels in the progeny did not increase, showing that hip mutants do not form in the course of the experiment. Rather, the late-term isolate is a persister mutant (Fig. 2C).

The late isolates also have an inactivating mutation in mexZ, encoding a repressor of the MexXY-OprM multidrug resistance (MDR) pump. This pump extrudes ofloxacin and other antimicrobials (38) and is frequently upregulated in isolates of P. aeruginosa from CF patients (53). The resistance of these strains to ofloxacin increased 8-fold compared to that in the early isolates (1 μg/ml) (Table 1). In order to establish whether the survival of late isolates was due to increased tolerance or increased resistance, the mexXY genes were deleted in the 96-month isolate. The resistance of the ΔmexXY knockout strain was restored to that of the early parent strain (ofloxacin MIC of 1 μg/ml) (Table 1). The survival of the parent, 96-month isolate, and isogenic ΔmexXY derivative of the 96-month isolate was then examined in a dose-dependent killing experiment with ofloxacin (Fig. 3A). The bulk of the cells of the parent isolate were highly susceptible to killing by ofloxacin, and surviving persisters formed a plateau at 10⁻⁴ to 10⁻³% of the total population. The 96-month isolate and its ΔmexXY derivative both showed an approximately 100-fold-higher plateau of surviving cells. The progeny of surviving persisters did not have increased resistance to ofloxacin (Table 1), indicating that surviving cells are not resistant mutants that form before or during antibiotic treatment. Since the ΔmexXY derivative and the early isolate have the same ofloxacin MIC, but ΔmexXY forms 100 times more persisters, we conclude that the 96-month isolate is a hip mutant.

• Open in new tab
• Download powerpoint

FIG. 3.

Separating resistance from tolerance in a 96-month isolate of P. aeruginosa. In each experiment, the same set of strains was examined: the parent (AMT0023-30), 96-month isolate (AMT0023-34), and the ΔmexXY (KLE2000) derivative of the 96-month isolate. (A) Stationary-phase cultures were incubated for 8 h with ofloxacin, and surviving cells were enumerated by colony count (percent survival ± SEM; n = 3). (B) Exponential-phase cultures were treated for 8 h with carbenicillin. Surviving cells were enumerated by colony count (percent survival ± SEM; n = 3). (C) Stationary-phase cells were treated with tobramycin (20× MIC), and the surviving cells were enumerated by colony count (percent survival ± SEM; n = 4). (D) Twenty-four-hour biofilms were treated with ofloxacin for 8 h, and surviving cells were determined by colony count (log [CFU/ml] ± SEM; n = 4).

An important hallmark of persisters is multidrug tolerance (36). If the late isolate is indeed a hip mutant, then it should be tolerant to unrelated antibiotics. Carbenicillin, a β-lactam, only kills rapidly growing cells (20, 50) therefore a dose-dependent experiment was performed with exponentially growing cultures. The 96-month isolate had a 2-fold increase in carbenicillin MIC, not a significant change considering that the intrinsic variation in the MIC test is 100% (7). The parent strain was readily killed with carbenicillin and formed a distinct plateau of surviving persisters (Fig. 3B). The late isolate and its isogenic ΔmexXY mutant had a similar pattern of killing and formed a considerably higher number of surviving persisters than the parent. Increased carbenicillin tolerance could have resulted from a simple decrease in the growth rate of the ΔmexXY strain. However, the ΔmexXY strain actually grows slightly faster than the parent isolate (Table 1). The MexXY-OprM pump is especially effective in extruding aminoglycosides (27), and the 96-month isolate is resistant to tobramycin, with a MIC 32 times higher than that of the parent strain (Table 1). The parent strain was rapidly killed by tobramycin at the stationary phase, with little evidence for surviving persisters (Fig. 3C). The ΔmexXY strain, in contrast, showed little killing in this time-dependent experiment, despite its increased susceptibility to tobramycin. Taken together, these results demonstrate that the late isolates from this patient are hip mutants that produce increased levels of multidrug-tolerant persister cells.

Drug tolerance in biofilms.Biofilm-like microcolonies of P. aeruginosa and quorum-sensing factors favoring biofilm development have been described in CF infection (46, 58). Biofilms also exhibit high levels of drug tolerance, largely due to the presence of persister cells (24, 48). At the same time, the involvement of biofilms in CF pathogenesis and drug tolerance remains controversial, since late isolates from CF patients often carry mutations affecting quorum sensing and biofilm formation. The late isolates (92 and 96 months) have a mutation in lasR and are reported to be deficient in biofilm formation (47). In order to investigate the effect of growth in a biofilm on drug tolerance of the hip mutants, biofilms were formed on prongs of the Calgary device (5), transferred to fresh medium, and exposed to ofloxacin. The parent strain formed a robust biofilm, as judged by the number of cells per peg (between 10⁷ and 10⁸ CFU/peg), but was highly susceptible to killing by ofloxacin (Fig. 3D). Under these conditions of high concentration of antibiotic and relatively long, 8-h incubation, no surviving persisters were observed. The 96-month isolate and its ΔmexXY derivative were unable to form a robust biofilm, and the number of cells per peg was approximately 100-fold lower than that of the parent strain (10⁵ CFU/peg). Nevertheless, both the 96-month isolate and the ΔmexXY strain formed a distinct plateau of surviving persisters. This strongly suggests that it is the increased persister formation of the hip mutants rather than the ability to form biofilms that is responsible for elevated antibiotic tolerance in both the biofilm and planktonic phases of growth.

Screening P. aeruginosa isolates from different patients for hip mutants.The results reported in the previous sections were obtained with a clonal lineage of P. aeruginosa strains isolated from a single CF patient. It was important to establish whether this was an isolated event or a common feature of the disease. Pairs of early/late isolates from 14 individual patients that were found to be clonal, based on multilocus sequence typing (47), were tested for their ability to form persisters. There was a wide variation in the absolute levels of persisters determined by exposure of stationary-phase cultures to ofloxacin at 50× MIC (Fig. 4). Of the 14 pairs, 10 showed an increased level of persisters in the later isolate and thus were deemed to be hip mutants. The increased frequency of persister formation was dramatic in some cases, ranging from a 100- to 10,000-fold increase. Such strong phenotypic changes are likely the result of stable mutations occurring in the late isolates, even though the complete spectrum of mutations within these strains is not known at present. These strains have a wide range of growth rates, with no correlation between growth rate and increased persister formation (Table 1). About half of the hip mutants grow faster than their clonal parental strain, while half grow slower. In addition, the high-persister phenotype is observed in the stationary phase where cells are not growing.

• Open in new tab
• Download powerpoint

FIG. 4.

A screen of P. aeruginosa clinical isolates for hip mutants. Stationary-phase cultures of clonal early/late isolate pairs from 14 patients were exposed to ofloxacin (50× MIC) for 8 h, and the surviving cells were determined by colony count (percent survival ± SEM; n = 4). Early isolates are indicated with white bars, while late isolates are indicated with black bars. The patient number and age at which the tested isolates were obtained are displayed on the x axis. A hip mutant emerged in 10 of the 14 patients. A hip mutant did not emerge in the isolates from the last four patients displayed on the right side of the graph.

Interestingly, among the 10 hip mutants, 7 did not show increased resistance to the tested antibiotics—ofloxacin, tobramycin, and carbenicillin (Table 1). Similarly to the late isolate from patient 1, the progeny of recovered persisters from these additional patients did not have an increase in resistance to ofloxacin (Table 1). Increased persister formation due to the acquisition of hip mutations appears to be the sole mechanism of increased tolerance to killing by antimicrobials in these isolates. In order to further probe the nature of these additional hip mutants, four of the strains that did not show increased antibiotic resistance were tested for survival with a different antibiotic, tobramycin, in a time-dependent killing experiment with stationary-phase cells. In all cases, the hip mutant identified in the screen with ofloxacin showed increased survival when treated with 20× the MIC of tobramycin (Fig. 5A to D). This suggests that the hip mutants emerging in independent patients produce increased levels of multidrug-tolerant persister cells.

• Open in new tab
• Download powerpoint

FIG. 5.

(A to D) Time-dependent killing of paired early/late isolates from different patients by tobramycin. Strains were grown to the stationary phase, treated with tobramycin (20× MIC), and the surviving cells were enumerated by colony count (percent survival ± SEM; n = 3). The age of the patient at the time the isolate was obtained (years old [y.o.]) is indicated.