Article Figures & Data
Figures
- FIG. 1.
(A) Uracil excision activity assay results for different stages of M. smegmatis growth. Cell extracts (1 μg each) from different stages of hypoxia and recovery phases were used for a time course analysis of uracil excision. The activity assays were performed for 0, 5, and 15 min at 37°C using a 32P-5′-end-labeled 30-mer DNA oligomer (PTU) containing uracil at the 12th position. In vitro mixing (lanes 12 to 14) refers to mixing of equal amounts of extracts from the 10-day hypoxia and recovery-phase cell extracts. M. smegmatis Ung (100 ng) was used as a positive control (lane 2). Following the reaction, the samples were further processed (see Materials and Methods) and analyzed on 8 M urea-15% polyacrylamide gels. S and P refer to substrate and product, respectively. (B) Immunoblot analysis of M. smegmatis cell extracts. (i) Equal amounts of cell extracts (∼30 μg) from different stages of hypoxia (3.5, 7.5, and 10 days) were separated on an SDS-15% polyacrylamide gel along with 200 ng of pure M. smegmatis Ung protein as marker (lane 1; M). The protein samples were transferred onto a PVDF membrane, probed with anti-M. smegmatis Ung antiserum, and developed using goat anti-rabbit IgG conjugated with HRP and using an enhanced chemiluminescence reagent. (ii) Equal amounts of cell extracts (∼30 μg) from 10-day hypoxia, 1-h recovery, and mid-log-phase cultures were separated on an SDS-15% polyacrylamide gel along with 200 ng of pure M. smegmatis Ung protein as marker (lane 1; M) and processed as described above. (C) Uracil excision activity assay results from different stages of M. tuberculosis growth. Cell extracts (1 μg each) from log-phase and 14-day hypoxia cultures were used for a time course analysis of uracil excision as described for panel A.
- FIG. 2.
Expression analysis of the narK2 promoter. (A) Schematic representation of the pMVnarK2ung construct, depicting the promoter of narK2 from M. tuberculosis H37Rv cloned upstream of M. smegmatis Ung. (B) The mycobacterial vector pMVnarK2ung was introduced into M. smegmatis ung::kan by electroporation. The strain was grown to mid-log phase and subjected to 10 days of hypoxia. Cell extracts (1 μg each) from mid-log (lanes 3 to 5) and hypoxia (lanes 6 to 8) stages were used in a time course assay for uracil excision using 5′-32P-end labeled PTU. Purified M. smegmatis Ung (100 ng) was used as a positive control (lane 2). S and P refer to substrate and product, respectively.
- FIG. 3.
Viable counts of M. smegmatis strains in mid-log and 10-day hypoxia cultures. M. smegmatis mc2155 harboring pMV361 alone or pMVnarK2ung, where ung is driven by the narK2 promoter (a hypoxia-specific promoter), and the ung::kan strain were grown to mid-log phase in triplicate in Dubos medium with ADC supplement and subjected to hypoxic culture (10-day hypoxia). Viabilities of the strains grown to mid-log phase (A) and after subjecting them to 10-day hypoxia (B) were determined by the serial dilution plating method. The differences in viable counts were analyzed for statistical significance by performing Student's t test using GraphPad Prism 4.03 software. *, P < 0.05.
- FIG. 4.
Analyses of DNA repair gene mRNAs by quantitative real-time PCR. Total RNA were isolated in triplicate and processed to remove contaminating DNA. The cDNA was synthesized using gene-specific primers. The mRNA levels were determined using quantitative real-time PCR mix containing SYBR green dye. Amplification of 16S rRNA was used as an internal control. The expression level of each gene was determined by the comparative CT method after normalizing with a 16S rRNA control. The mean expression levels ± standard deviations for each gene under different conditions are plotted (using a log2 scale), and the differences in expression were analyzed for statistical significance by performing a paired Student's t test using GraphPad Prism 4.03 software. *, P < 0.05.
- FIG. 5.
Model of detrimental effects of Ung deficiency and misexpression during hypoxia. Bacterial physiology during the log phase (extreme left) is characterized by high metabolism and efficient DNA synthesis and repair. Under hypoxic stress (step 1), bacterial metabolism declines and is characterized by low DNA synthesis (39) and repair (present study). The ability of hypoxia to inflict DNA damage may lead to persistence of bacteria with damage in the genome (depicted by the dotted line). Release of bacteria from hypoxia to normal oxygen conditions (step 2) leads to reactivation of DNA repair processes (present study), and repair of the accumulated damage (depicted by the bold line) allows bacterial multiplication. Misexpression of Ung (step 3) under hypoxia leads to untimely excision of uracil in DNA, committing the bacteria to the base excision repair pathway even when the downstream repair functions may be deficient. Inability to complete DNA repair leads to accumulation of AP sites and other damage, such as DNA breaks (depicted by the broken line), which are detrimental to bacterial survival. In such a model, Ung deficiency at step 2 would lead to deficient uracil repair, an increase in C-to-T mutations, and detrimental effects on survival. Misexpression of Ung at step 3 would result in excessive uracil release and accumulation of AP sites and other irreparable DNA damage, which too would be detrimental to the survival of the bacteria.
Tables
- TABLE 1.
DNA oligomers and plasmids
Oligomer or plasmid Sequence (5′ to 3′) or description Reference or source Oligomers Msm-hspXRT_Fp CGGCGTGTTGACCATCAAG This study Msm-hspXRT_Rp GATCGTGAGGATGCCTTTGTC Msm-udgBRT_Fp GGCACAGTGGACGGGTGT Msm-udgBRT_Rp GAGATCATCGCGTCGAGGTC Msm-16SRT_Fp AAGCGCAAGTGACGGTATGTG Msm-16SRT_Rp AAGCTGTGAGTTTTCACGAACAAC Msm-ungRT_Fp GCAGCCTGTCCAACATCTTCAC Msm-ungRT_Rp CGGCCTCCCATCCTTTACC Msm-mutMRT_Fp CACGTCGTTCGATTCGTTGTAC Msm-mutMRT_Rp GCTGACATCTCGGGCAGTAGA Msm-uvrBRT_Fp GATGGCGCCCAACAAGAC Msm-uvrBRT_Rp CGTTGATCGAGCTGTCCTTCTC narK2_Fp GATATCGTGATCCGACTGGTCGCC narK2_Rp CCATGGCGAACTCCGCGCCCC PTUa 5′-A∼T∼ATACCGCGGUCGGCCGATCAAGCTTA∼T∼T-3′ 16 Plasmids pJet1.2 E. coli vector for cloning PCR products MBI Fermentas pRARE E. coli plasmid (p15a origin of replication, Cmr), encodes tRNA genes (proL, leuW, metT, argW, thrT, glyT, tyrU, thrU, argU, and ileX) Novagen pETMsmUng pET 11D E. coli expression construct harboring ung ORF from M. smegmatis SN2 between NcoI and EcoRI sites (renamed from pETMsmUDG) 2 pRSETbMsmUng pRSET E. coli expression construct harboring M. smegmatis ung between NcoI and HindIII sites along with a 40-amino-acid N-terminal presequence This study pRSET-11-MsmUng Derivative of pRSETbMsmUng in which the N-terminal 40-amino-acid presequence has been reduced to 11 amino acids pTrcHisMsmUng E. coli expression construct with M. smegmatis ung along with 11-amino-acid N-terminal tag from pRSET-11-MsmUng cloned between NdeI and HindIII sites pTrcMsmUng pTrc99c harboring M. smegmatis ung ORF between NcoI and HindIII sites 1 pJet1.2narK2 pJet vector containing ∼300 bp of narK2 promoter within EcoRV and NcoI sites This study pTrcnarK2ung pTrcMsmUng vector with narK2 promoter cloned upstream of ung ORF between EcoRV and NcoI sites This study pMV361 (Hygr) Integrative vector in mycobacteria containing L5 att region with E. coli origin of replication and Hygr marker 33 pMV361Δhsp Derivative of pMV361 vector with hsp60 promoter truncated by BsrDI digestion, end filled, and ligated This study pMVnarK2ung pMV361Δhsp in which narK2ung from pTrcnarK2ung has been cloned between PvuII and HindIII sites This study ↵ a The ∼ symbols indicate phosphorothioate modifications in the oligonucleotide.
- TABLE 2.
List of M. smegmatis strains used in the study
M. smegmatis strain Relevant characteristic(s) Reference SN2 Laboratory strain 23 mc2155 or wild type High-efficiency transformation strain 31 WT(L5 att::pMV361) mc2155 harboring an integrative vector, pMV361 (Hygr), at the L5 att site of the chromosome This study ung::kan strain mc2155 with ung gene disrupted with kan cassette 36 ung::kan(L5 att::narK2ung) strain ung::kan strain harboring the integrative vector, pMVnarK2ung (Hygr), at the L5 att site of the chromosome This study WT(L5 att::narK2ung) mc2155 strain harboring pMVnarK2ung at the L5 att site of the chromosome - TABLE 3.
Spectrum of mutations in the RRDR locus of rifampin-resistant isolates of three M. smegmatis strains
Mutations detected % of M. smegmatis isolates with indicated mutations (no. with mutations/total)a WT (hyg)b ung::kanc pMVnarK2ungd A→G, T→C 43 (18/42) 14 (4/28) 72 (34/47) C→T, G→A 45 (19/42) 86 (24/28) 21 (10/47) C→G, G→C 5 (2/42) None 2 (1/47) C→A, G→T 5 (2/42) None None A→C, T→G 2 (1/42) None 4 (2/47) ↵ a Bacterial cultures (five replicates for each strain) were subjected to hypoxia and, at the end of the 10-day incubation, plated on medium containing rifampin. The RRDR loci from the rifampin-resistant colonies were sequenced. Values in parentheses are the number of isolates with the indicated mutations/the total number with mutations in the RRDR locus.
↵ b A total of 50 samples were sequenced for mutations in the RRDR, of which 8 samples did not have mutations.
↵ c A total of 45 samples were sequenced for mutations in the RRDR, of which 17 samples did not have mutations.
↵ d A total of 63 samples were sequenced for mutations in the RRDR, of which 16 samples did not have mutations.
