Article Figures & Data
Figures
- FIG 1
SEM images of M. penetrans whole cells and detergent-insoluble structures. (A) Field of M. penetrans cells. Arrows, connecting filaments. Scale bar, 1 μm. (B) Individual M. penetrans cell. Arrow, AO. Scale bar, 200 nm. (C and D) Detergent-insoluble structures from M. penetrans cells extracted with Triton X-100 (C) or Tween 20 (D). Asterisks, wide ends of structures. Scale bar, 200 nm.
- FIG 2
AO-associated objects and their lengths. (A) Distribution of the lengths of TXI objects observed by SEM. (B) Distribution of the lengths of nucleoid-free zones observed by light and fluorescence microscopy. (C) Distribution of the lengths of TWI objects observed by SEM. (D) Correspondence of the lengths of nucleoid-free zones to the fractions of the cell length occupied by the nucleoid-free zones in 52 cells with a single nucleoid-free zone. (E and F) Correspondence of the lengths of nucleoid-free zones to the fractions of the cell length occupied by the nucleoid-free zones in 16 cells with two nucleoid-free zones, a shorter one (E) and a longer one (F). (G) Example of nucleoid-free zones. Black, cell outline viewed by phase-contrast microscopy; white, nucleoid stained with DAPI. Arrows, nucleoid-free zones, measured along the long axis of the cell for panel B. Scale bar, 500 nm.
- FIG 3
Internal organization of M. penetrans observed by ECT. (A to C) Sections of different whole cells. (D to F) Corresponding schematics. In panels A to C, ∼20-nm granules are ribosomes (reviewed in reference 70). The insertion site of a connecting filament was observed at one cell pole (C and F). Black lines, cell membranes and boundaries of ribosome-free zones; circles, ribosomes (positions are schematic and do not represent actual ribosomes); arrow in panel F, location of connecting filament. Scale bars, 100 nm.
- FIG 4
SDS-PAGE of the M. penetrans whole-cell lysate and TWI and TXI proteins. A total of 22 μg each of protein from the whole-cell lysate (lane 2), the TWI fraction (lane 3), and the TXI fraction (lane 4) was separated by SDS-PAGE for comparison and for excision of candidate bands chosen for identification. Lane 1 contains protein standards, with sizes indicated to the left. The 66-kDa band in lane 4 was present only in some preparations. Numbers in the gel indicate specific bands chosen for MALDI-TOF mass spectrometry and correspond to protein identifications in Table 1.
- FIG 5
RT-PCR analysis of the putative cytoskeletal operon of M. penetrans. (A) Agarose gel containing PCR products from RT-generated transcripts that span the gene junctions numbered in panel B. Top, products amplified from reverse-transcribed RNA using a primer complementary to a region at the 3′ end of mype1570; bottom, products amplified from genomic DNA used as a positive control. (B) Schematic of genes encoding MYPE1520 to MYPE1570, showing the genomic orientation and relative sizes, including the 5′ and 3′ flanking genes. Numbers 1 to 7 refer to the positions of the primer pairs used to span gene junctions for RT-PCR.
Tables
- TABLE 1
TXI and TWI proteins identified by MALDI-TOF
Protein Band no. in Fig. 4 Functional annotation Size (kDa) MYPE1530 3 NAa 122 MYPE1550 1 NA 386 MYPE1560 4 NA 99 MYPE1570 4 NA 93 MYPE4000 2 NA 99 MYPE5100 6 Pyruvate dehydrogenase subunit E2, PdhC 51 MYPE6630 8 P42 lipoprotein (P35 family) 42 MYPE6810 9 P35 lipoprotein (P35 family) 38 MYPE6960 3 Lipoprotein 138 MYPE8750 5 Oligopeptide ABC transporter ATP-binding protein, OppF 92 MYPE9640 9 Lactate dehydrogenase, Ldh 34 MYPE10090 7 Ribosomal subunit S3, RpsC 48 ↵a NA, not applicable.
- TABLE 2
Comparison of AO protein features
Species and protein Coiled coil Molecular mass of >70 kDa Extreme pI (<5 or >9) Total no. of features M. pneumoniae HMW1 (MPN447) X X X 3 HMW2 (MPN310) X X X 3 HMW3 (MPN453) X X 2 P24 (MPN312) 0 P41 (MPN311) X X 2 P65 (MPN309) X X 2 P200 (MPN567) X X 2 TopJ (MPN119) X X 2 M. mobile MMOB0150 0 MMOB1620 0 MMOB1630 X X 2 MMOB1640 0 MMOB1650 X 1 MMOB1660 0 MMOB1670 0 MMOB4530 X 1 MMOB4860 X 1 MMOB5430 X 1 M. penetrans MYPE1530 X X X 3 MYPE1550 X X X 3 MYPE1560 X X X 3 MYPE1570 X X X 3 MYPE4000 X X X 3 MYPE5100 0 MYPE6630 0 MYPE6810 0 MYPE6960 X X 2 MYPE8750 X X X 3 MYPE9640 0 MYPE10090 0 - TABLE 3
Primers used for RT-PCR
Primer designation Sequence (5′ to 3′) Target Product size (bp) 1510end(up) AATGAGCAGTAAGTGCTAGC MYPE1510-MYPE1520 603 1520begin(down) GTCTTAGGAATTTGAACAGGTG 1520end(up) GGAAAAAGAAGCTGTCACAG MYPE1520-MYPE1530 566 1530begin(down) GGTTGATTGTCAGCAGAACC 1530end(up) TTCCAGCTCCTGCATATGAC MYPE1530-MYPE1540 527 1540begin(down) GTCAGTTCCCTGAAATTGTTC 1540end(up) CTAAATTGTTCCAATATTGAATAATCGC MYPE1540-MYPE1550 454 1550begin(down) ATAGATGAGATTCTTTATCAAAGTTCTC 1550end(up) ATCAAACCCAAGCGATTCTG MYPE1550-MYPE1560 541 1560begin(down) TCAACATCGTCTTGTCTTGG 1560end(up) TGCTCCTAGTAGTGAGTTGC MYPE1560-MYPE1570 696 1570begin(down) CTTCTCTAGCTTGAACTTGG 1570end(up) TTTGGAAGACCAGCAGGAAG MYPE1570-MYPE1580 380 1580begin(down) GTGTTGCCAGGTCTAAGATC 1580RT(down) CATAGCCGTTTGAACAGTGT NAa NA ↵a NA, not applicable.
Supplemental material
- Supplemental file 1 -
Data Set S1, RNA-Seq data
XLS, 655K
- Supplemental file 1 -
