Increased Excess Intracellular Cyclic di-AMP Levels Impair Growth and Virulence of Bacillus anthracis

Bacterial strains, plasmids, and growth conditions.The bacterial strains and plasmids are listed in Table S1 in the supplemental material. Parental B. anthracis Sterne(pXO1⁺, pXO2⁻) and its mutants were grown in either Luria broth (LB) or brain heart infusion (BHI) broth (Oxoid) under aerobic conditions at 37°C. The ΔgdpP, ΔpgpH-HD, and ΔΔPDE strains were generated by a previously described method (25, 37). The markerless gene replacement method was utilized with modifications. Briefly, for deletion of gdpP, the pRP1028-gdpPUD construct was created by cloning two 1-kb fragments containing gdpP locus flanking regions in the Mlu site of pRP1028. pRP1028-gdpPUD was first transferred into B. anthracis through conjugation with the help of pSS1827. The mating mixture was incubated on a BHI plate for 24 h at 25°C. Then, the mixture was transferred to BHI broth containing 250 μg ml⁻¹ spectinomycin and 65 units ml⁻¹ polymyxin B and incubated for 2 days at 25°C. During this period, pRP1028-gdpPUD was integrated into the Sterne genome. The redundant plasmid pRP1028-gdpPUD was eliminated by shifting the temperature to 37°C. pSS4332 was introduced into the single-crossover insertion strain through the second conjugation with the help of plasmid pSS1827. The conjugation time was reduced to 6 to 8 h, and the selection plates were changed to BHI broth containing 20 μg ml⁻¹ kanamycin and 65 units ml⁻¹ polymyxin B. pRP1028-gdpPUD was used to make the ΔgdpP mutant by allelic exchange. The expression of I-SecI by pSS4332 caused a double break in the Sterne-pRP1028-gdpPUD, resulting in either the ΔgdpP strain or restoring the parental strain. The ΔgdpP mutation was confirmed by PCR amplification (see Fig. S3). Finally, the redundant plasmid pSS4332 was eliminated by continuous passage at 37°C.

Complemented strains were generated using the shuttle vector pDG148 (38). For the complementation, the gdpP or pgpH gene with the Shine-Dalgarno (SD) sequence was amplified with PCR and inserted into pDG148 that can express under the Pspac promoter. The insertion was performed by the fast cloning method. The plasmids pDG148-gdpP and pDG148-pgpH were transferred into the ΔΔPDE strain to make the complemented strains ΔΔPDE-gdpP and ΔΔPDE-pgpH. The complementary experiments were performed in the absence of IPTG due to a small amount of leaky expression of Pspac promoter (39). To generate the expression plasmid pDG148-atxA, the atxA gene with SD sequence was amplified from genomic DNA by primers (pDG148atxAF, AAGCTTAAAGGAGGAAGCAGGTATGCTAACACCGATATCCATCGAA; pDG148atxAR2, GCATGCTTATATTATCTTTTTGATTTCATGAAAATCTCTTTCT) and inserted into HindIII- and SphI-digested plasmid pDG148.

The fidelity of all molecular constructs was confirmed by PCR and DNA sequencing. Primers for PCR used in this study are listed in Table S2.

Determination of doubling time.Strains were grown overnight in LB medium and diluted 1:100 in 10 ml fresh BHI (0.8% NaHCO₃) medium. The optical density at 600 nm (OD₆₀₀) of the culture was measured hourly. The OD₆₀₀ values in the exponential-phase log₁₀(OD₆₀₀) demonstrated a linear increase over time: r = (ln [OD2/OD1])/(T2 − T1). Doubling time corresponds to ln2/r. The reported data represent the means and standard errors derived from three independent assays. Lag times were determined by measuring the time to reach the exponential phase from inoculation.

S-layer fractionation.Overnight growth bacterial cultures were diluted 1:1,000 in BHI medium (0.8% NaHCO₃). The cultures were incubated at 37°C for 18 h. One milliliter of culture was sedimented by centrifugation at 170,000 × g for 3 min. The supernatant (the medium fraction) was separated from the sedimented cells. The cells were washed twice with PBS and suspended in 1 ml PBS supplemented with 3 M urea. The solution was heated for 10 min at 95°C to extract S-layer and S-layer associated protein (S-layer fragment). After centrifugation (10,000 × g, 10 min), the supernatant containing the S-layer fragment was transferred to a new tube. The remaining cells were washed twice with PBS and mechanically lysed by sonication. After centrifugation (10,000 × g, 10 min), the supernatant (cellular fraction) was transferred to a new tube. Proteins in the medium, S-layer, and cellular fractions were precipitated overnight at 4°C with 10% trichloroacetic acid (TCA). Precipitates were collected by centrifugation (10,000 × g, 15 min), resuspended in 100 μl of 1 M Tris-HCl (pH 8.8), and mixed with equal volumes of sample buffer (4% SDS, 1% β-mercaptoethanol, 10% glycerol, 50 mM Tris-HCl [pH 7.5], bromophenol blue). The protein samples were separated on 10% SDS-PAGE gels and analyzed by Coomassie staining and immunoblotting.

Assay of anthrax toxin in supernatants.Sterne strain and deletion mutants were inoculated in 5 ml LB broth and incubated overnight at 37°C. Secondary inoculation (0.1%) was performed in 5 ml BHI medium (0.8% NaHCO₃). The cultures were incubated at 37°C for 18 h. One milliliter of cultures was precipitated at 17,000 × g for 15 min, and supernatants were collected. Proteins were precipitated overnight at 4°C with 10% TCA. Precipitates were collected by centrifugation (10,000 × g, 15 min), resuspended in 100 μl of 1 M Tris-HCl (pH 8.8), and mixed with equal volumes of sample buffer. The protein samples were separated on 10% SDS-PAGE gels and analyzed by immunoblotting. For the immunoblotting assay, protein samples were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). Membranes were blotted with antibodies against EA1 (1:500 dilution; provided by Xian-En Zhang, Institute of Biophysics, CAS) (40), LT (1:500 dilution; Abcam catalog number ab13805, RRID:AB_300649), PA (1:1,000 dilution, Abcam catalog number ab13808, RRID:AB_300652), BslA (provided by Chun-Jie Liu, Beijing Institute of Biotechnology; 1:1,000 dilution) (41), and L6 (provided by Chun-Jie Liu, Beijing Institute of Biotechnology; a ribosomal protein in the cytoplasm, 1:1,000 dilution) (Wang et al. [42]), and then with goat anti-mouse (only EA1) or anti-rabbit IgG horseradish peroxidase (HRP)-conjugated secondary antibody (1:5,000 dilution).

Quantitative real-time PCR.Total mRNA was extracted from B. anthracis Sterne strain and deletion mutants, which were grown in BHI medium (0.8% NaHCO₃), with a Bacteria RNA extraction kit (R403-01; Vazyme Biotech Co., Ltd.) and reversed transcribed using a QuantiTect reverse transcription kit (Qiagen, Valencia, CA). cDNAs were used as the templates for real-time quantitative reverse transcription (qRT)-PCR analysis of selected genes with a CFX96 real-time PCR detection system (Bio-Rad, CA). iQ SYBR green Supermix (Bio-Rad, CA) was used for all RT-PCRs. Primers used are listed in Table S2. gapdh was used as the internal control. The amplification efficiency was 0.9 to 0.99.

Protein expression and purification.The cytoplasmic portion of GdpP_84-657 was first amplified from the genomic DNA and cloned into pET28a between the NcoI and XhoI restriction sites. The plasmid was then transformed into the Escherichia coli BL21(DE3) strain. The GdpP-6×His fusion protein was expressed in BL21(DE3) and purified as previous described (43). Briefly, 1 liter of bacterial culture in LB was grown to an OD₆₀₀ of 0.8 before inducing with 0.8 mM isopropyl β-d-thiogalactopyranoside (IPTG) for 16 h at 16°C. Cells were pelleted and resuspended in 20 ml lysis buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 5% glycerol, 0.1% mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride). Cells were subjected to disruption by sonication on ice for 30 min. Crude cell extracts were centrifuged at 17,000 × g for 30 min, and the supernatant was filtered and loaded onto Co²⁺ resin for affinity purification. After washing, proteins were eluted with elution buffer containing 50 mM Tris (pH 8.0), 150 mM NaCl, and 80 mM imidazole. After analysis by SDS-PAGE, fractions with >90% purity were pooled and dialyzed overnight at 4°C in 50 mM Tris (pH 8.0) and 150 mM NaCl. Five percent glycerol was added before storage at −80°C. The protein concentration was determined by the Bradford assay method. Maltose binding protein (MBP)-tagged B. anthracis HD protein was purified from 1 liter of induced E. coli BL21(DE3) culture containing the pMal-c2x expression plasmid. Protein induction and purification were performed as previously described (19).

Enzymatic assay.The phosphodiesterase assay conditions were conducted as described previously, in which 1 μM GdpP_84-657 and PgpH-HD were incubated with 100 μM c-di-AMP (Sigma) in buffer (100 mM Tris [pH 8.3], 20 mM KCl, 0.5 mM MnCl₂). The reaction was carried out at 37°C for up to 2 h. The reaction was terminated by boiling for 5 min, and the mixture was filtered to remove the denatured protein.

The supernatants (each 20 μl) were injected into the LC C₁₈ column and separated by reversed-phase HPLC (Agilent 1200). The following buffers were used in the gradient program: buffer A (50 mM KH₂PO₄, 4 mM tetrabutyl ammonium hydrogen sulfate) and buffer B (75% buffer A, 25% methanol). The following protocol was used for separation: 0.0 min, 0% buffer B; 2.5 min, 0% B; 5.0 min, 30% B; 10.0 min, 60% B; 14.0 min, 100% B; 21.0 min, 100% B; 22.0 min, 50% B; 35.0 min, 0% B at a flow rate of 0.7 ml min⁻¹. Nucleotides were detected at a wavelength of 260 nm.

Quantification of intracellular c-di-AMP concentration.The Sterne strain and three different PDE mutants were cultivated in 10 ml BHI (0.8% NaHCO₃) medium at 37°C for 18 h. Five milliliters of the cultures was harvested immediately by centrifugation at 4°C, and the cell pellets were extracted by the nucleotide extraction method reported previously (44, 45). Pellets were resuspended in 1 ml methanol (filtered at 0.22 μm). Ten microliters was used for ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis, which was performed on Shimadzu UPLC-LC20AD coupled to an AB API4000 LC-MS/MS with an RP C₁₈ column (250 mm by 4.6 mm, Thermo Hypersil GOLD). The following buffers were used in the isocratic elution with a flow rate at 0.3 ml min⁻¹: buffer A consisted of 10 mM ammonium acetate (NH₄AC; pH 5.5) and buffer B contained 100% methanol. The intracellular c-di-AMP concentration was determined based on a c-di-AMP (MCM) standard plotting peak areas versus concentrations and was presented as picomoles of c-di-AMP per milligram wet weight Bacillus anthracis. Measurements were repeated in triplicates, with the same retention time as for c-di-AMP.

Macrophage association assay.RAW 264.7 cell lines (RRID:CVCL_0493) were purchased from Cell bank, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences. RAW 264.7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco).

For the association assay, 10⁴ cells were cultivated for 2 days in 24-well plates (46). The cells were washed twice with PBS prior to the adhesion assay. The strains were grown in 5 ml BHI (0.8% NaHCO₃) medium for 18 h and diluted in DMEM (1% FBS, 80 μM IPTG) to a concentration of 5 × 10⁵ CFU ml⁻¹. Six hundred microliters of bacterial suspension was added to each well. The cells and bacteria were cocultured at 37°C with 5% CO₂ for 2 h. Then, the cell monolayers were washed with PBS three times and lysed with 0.1% Triton X-100. The associated bacteria were calculated as the percentage of initial inoculum and adjusted to be expressed as percent change compared to the parental strain.

Salt stress adaptation.Stationary-phase bacteria were diluted 1:100 (vol/vol) in 5 ml of fresh BHI broth at 37°C with shaking at 200 rpm. When an OD₆₀₀ of 0.5 was reached, the culture was inoculated into BHI broth supplemented with mild (2.5% or 3.5%) and severe (4.5%) salt at a starting OD₆₀₀ of 0.01. The cultures were inoculated at 37°C with shaking at 200 rpm, and the growth was monitored for 9 h.

Dilution spot test to check sensitivity to Triton X-100.Stationary-phase cells were resuspended with PBS or PBS with 0.1% Triton X-100 for 0.5 h. The cells were subjected to 10-fold serial dilution, and 2 μl of each dilution was spotted on LB plates for incubation at 37°C overnight.

Mouse challenge experiment.All mouse experiments were conducted in a biosafety level 2 (ABSL2) laboratory with the approval of the animal experiments committee of Wuhan Institute of Virology, Chinese Academy of Sciences (approval number WIVA18030E). Animals were randomized, and each cage housed 3 or 4 mice. Seven- to nine-week-old C57BL/6J mice (n = 10) or A/J mice (n = 8) were injected with 10× median lethal dose (LD₅₀) of vegetative cells of the Sterne strain or ΔgdpP, ΔpgpH-HD, or ΔΔPDE isogenic mutants in a 200-μl volume. Colony counts were verified by plating. The mice were monitored for 10 days. Survival curves were generated and analyzed using the Kaplan-Meier method.

Statistical analysis.Data in Fig. 5 were analyzed by two-tailed Student's t test. Data in Fig. 2, 3, and 6 were analyzed by using one-way analysis of variance (ANOVA) followed by Turkey’s posttest analysis. Kruskal-Wallis one-way ANOVA followed by Dunn’s multiple-comparison test was used for comparisons in Fig. 4. The log rank test was used for survival analysis in the mouse model shown in Fig. 7.