Article Figures & Data
Figures
- FIG 1
Tn-seq analysis of L. pneumophila strain HL77S. (A) Log10 read counts of transposon insertions after initial library isolation (black) and second isolation (blue). Genes identified as essential are in magenta, and fitness determinants are in orange. Other genes of interest are in green. (B) Transposon insertion coverage in a region encompassing an integrative conjugative element (ICE) harboring essential genes (magenta) and genes encoding a conjugative system (green). The duplicated sequence GCGGGTTCGATTCCCGCCGCCTCCACCA of the tmRNA and located 66 kb away delineates the boundaries of the ICE. (C) Essential genes and fitness determinants in the conjugative plasmid of HL77S.
- FIG 2
Identification of genes required for natural transformation by Tn-seq. (A) Scatterplot of fold change (log2) of insertions in the corresponding genes in two tested transformation conditions. HL77S was subjected to natural transformation with a 4-kb PCR fragment of the legK2 or ihfB genes interrupted by a kanamycin resistance gene. Reads counts per gene were determined and expressed as fold change between the nontransformed population and the legK2::kan- or ihfB::kan-transformed populations. Individual genes (gray dots) were considered to be required for natural transformation if log2FC was >2 or <−2 and if P was <0.05 under one (magenta dots) or both (blue dots) conditions. (B) Natural transformation efficiency of reconstructed mutants in the Paris rocCTAA strain, which is constitutively competent for natural transformation. Transformation experiments were performed at least three times independently, and transformation frequencies were plotted (gray dots) along with the geometric means (black lines). (C) Natural transformation efficiency of the reconstructed ΔletA mutant in the original Paris strain and the constitutively competent Paris rocCTAA strain. Transformation experiments were performed twice independently, and transformation frequencies were plotted (gray dots) along with the geometric means (black lines).
- FIG 3
PilA2 is the major pilin of the L. pneumophila transformation pilus. (A) Western blot analysis of ectopically expressed PilA2-FLAG (encoded by p1890F) and PilE (encoded by p0681F) as a function of the IPTG inducer. (B) Complementation of the ΔpilE and ΔpilA2 mutants in the Paris rocCTAA strain by the ectopic expression of PilA2-FLAG (encoded by p1890F) and PilE (encoded by p0681F). Transformation frequencies were determined four times independently as a function of the IPTG inducer and normalized to 1 for the parental strain (Paris rocCTAA).
- FIG 4
PilA2 assembly into extracellular filaments depends on pilE, the operon lpp1976–lpp1978, and pilZ. (A) Visualization of PilA2-FLAG filaments (green) by immunofluorescence microscopy using fluorescein-conjugated anti-FLAG antibody. Bacteria were visualized by labeling DNA with Hoechst 33288 (magenta). (B) Western blot detection of extracellular PilA2. Bacteria were vortexed to release pili which were precipitated from supernatants. PilA2-FLAG was detected in supernatant and whole-cell lysates (pellet) using anti-FLAG antibodies. (C) DNA uptake assay of the reconstructed mutants defective for natural transformation. The transformation-deficient mutants were tested for the ability to internalize pGEM-HYG1, a nonreplicative plasmid. Following incubation with the DNA and subsequent DNase I treatment, the internalized DNA was detected in cells by PCR for pGEM-HYG. As a control, chromosomal DNA was also detected by PCR. This multiplex PCR was analyzed by agarose gel electrophoresis and labeling of DNA with ethidium bromide. Images are representative of experiments performed three times independently.
Additional Files
Supplemental material
- Supplemental file 1 -
Fig. S1, Table S1, and Data Set S1 legend
PDF, 225K
- Supplemental file 2 -
Data Set S1
XLSX, 2M
- Supplemental file 1 -
