TABLE 3

List of primers used in this study

PrimerSequence (5′→3′)Reference
phoP-F2aTCTAGCGGCCGCGTGCTCAAGACGGTATAGCACC
phoP-RaTTAGGATCCAGAGGTCGCGGCGTAGGTATTG
phoP-mut1bAAGTCATTACGACTATTCGTGGCCAGGGATATCGTTTTGAC
phoP-mut2bGTCAAAACGATATCCCTGGCCACGAATAGTCGTAATGACTT
phoP-qRTFTGTTGCGTCACCATCTGACA
phoP-qRTRTCACCGGGCAAACCAAGAT
ugd-RTFGCTCCGTTGGTCAAAGAAAA
ugd-RTRCCGTCTTCATCAGGAGGTGT
yr005 (16S rRNA)_fTGAACCCAGATGGGATTAGC51
yr005 (16S rRNA)_rCGCTTTACGCCCAGTAATTC51
mgtC-RTFGCACAGATTGTTTCGGGAAT
mgtC-RTRGACCACAAAGCACACCAATG
pmrH-RTFCATGCGATCGCTGTATGTTC
pmrH-RTRCACGTCTGTGATGGCGTAAT
ugd-EMSA-F2 (CO92-YPO2174EMSA-F)biotin(TEG)-GCTTAACAATGGTGTCCC17
ugd-EMSA-R2 (CO92-YPO2174EMSA-R)biotin(TEG)-ACTCCCAGTGATTATCGG17
pmrH-EMSA-F1biotin(TEG)-GCGTTAAATCCAACTCATTG
pmrH-EMSA-R1biotin(TEG)-GCGATCGCATGTTTGCAAC
  • a Underlined letters represent specific restriction sites added to the primer.

  • b Letters in boldface font represent specific nucleotide changes that were introduced by the site-directed mutagenesis, and the underlined letters show the MscI restriction site that has been introduced by the change.