Table 1.

Primer sequences

PrimerSequenceaPurposeb
ARG5-5DRAAGTGTTTCTTAGAGCAAAACTTGCGTTTGGTGACAGCTTTGGAAAAAATTGGTGTTCACGTTTTCCCAGTCACGACGTT Disruption of ARG5
ARG5-3DRATCTTGGCAAATGTTGTAATAAATCGTGAATTTCCTTGATCTTCAATTTAGTACCATATTTGTGGAATTGTGAGCGGATA Disruption of ARG5
ADE2-5DRGTCCATTATATGCTGAAAAATGGTGTCCTTTCACCAAAGAATTGGCTGTGGTTTTCCCAGTCACGACGTT Disruption of ADE2
ADE2-3DRGGGTTGCCTTATCACCCAAGACATTCAACATAATAGCATTGGTGATGGAATGTGGAATTGTGAGCGGATA Disruption of ADE2
ARG4-N2KATTCGGATCCGGTACCCCCCTTTAGTAAGATTTTTCAAGAGTAG ARG4cloning
ARG4-CSATTCTCGAGCCCGGGCAATGCTTGAGGAGAAGAATCAGAACGC ARG4cloning
ca-ura-5TTGGATGGTATAAACGGAAACA URA3cloning
ca-ura-3TCTAGAAGGACCACCTTTGATTG URA3cloning
ca-his-5CCTGGAGGATGAGGAGACAG HIS1 cloning
ca-his-3CCAATATATCGGTTGCACCA HIS1 cloning
5-detectGTTTTCCCAGTCACGACGTTGTAAAACGACDetection of vector sequences flanking disruption marker
3-detectTGTGGAATTGTGAGCGGATAACAATTTCACDetection of vector sequences flanking disruption marker
hisG-NCGCGATACAGACCGGTTCAGACAGGADetection ofhisG sequences
hisG-CTGGTCTTTACTCCATCACAGGGTTCCDetection ofhisG sequences
RIM101-5DRACGATCATTGTGTGACGACCATGTTGGTAGAAAGTCTTCGAACAATTTGTCATTGACTTGTGTGGAATTGTGAGCGGATA Disruption of HRM101
RIM101-3DRACATGGACTCTCAAGTGAGAAGTAATGTGATCTCTCTAACTGTAGTTGTGCCACAATTTTTTTCCCAGTCACGACGTT Disruption of HRM101
RIM101-5aGGGGAATTCGTGCTAATCAATCTAACACCACAGCTCTGCDetection of HRM101 alleles
seq7GGTGAACTCAGCCAGAACCTGCGDetection of HRM101alleles
PalA-5DRGCAGCACAAGAGTTAATTAAGAAAGTAGATAAAATGAAACAATATTTGTTACAGGCTAACAACGGAGATGGGTGGAATTGTGAGCGATA Disruption of ENX3
PalA-3DRGGAACGAGTTACTAATAGCTAATTCTAAGTCTCGACTCTCAACTCTTCGTCTATACAAATATTCCTCACTTTCCCAGTCACGACGTT Disruption of ENX3
PalA5′ACTGATGATGCAGCACAAGAGDetection ofENX3 alleles
PalA3′CCAGGTTTACTAATAGTCGGDetection of ENX3 alleles
  • a Boldface sequences in 5DR and 3DR primers are segments that anneal to plasmids pGEM-HIS1, pGEM-URA3, and pRS-ARG4ΔSpeI for amplification of disruption cassettes.

  • b Relevant use of primer in this study.