Table 2.

Oligonucleotides used for PCR and sequencing

Name Nucleotide sequence (5′-3′)
ANK36GTGGATCCCCAGGCTTAGCCCTTCAATCGTTTC
ANK37CGTACCGCCCCGGGCGTTATCTTCCGTACCTAG
ANK38CCCGGGGCGGTACGATGAAGAATCCAAC
ANK39GTGGATCCCACCCCGGCTAAAATATGTATTG
ANK49GCAGGATCCATGTTATCCTCATATAAAATAAAC
ANK50CCAGGTACCTTAATACGACAGTGGAATATG
ANK7191GCTTTATTCTGGCTCTCAAAAACG
AE19a CAGGTCGTCGTGTCTGCTAAA
KSCeaeACAGACATCTAGTGAGCAGC
ANK292GGATCCCGGGAGCAGCTTCTCGATTGTCG
  • a This oligonucleotide has been described elsewhere (23).