Table 2.

Oligonucleotides used in this study

NamecGenePosition (nt)StrandSequence (5′–3′)Primer set/amplicon size (bp)
P1 cdtB 1214–1165CGGCGTGACACGATAGCTAAGTTCACTCGGTTTGCCCCAACATCTAAACGNAa
P2 lspA1 6165–6185+TGAATTCAAACCGAAGTGAATGCCCAAGP2-P3b/997
lspA2 6139–6159+
P3 lspA1 7161–7139TTCTCGAGTGTTCTGCCGCAATTTCCTCC
lspA2 7136–7114
P4 lspA1 5225–5247+TTGGATCCAAATTGGAATGATTTGACCACP4-P5/459
P5 lspA1 5683–5659TTGAATTCTAGGTTTTCAAAACTGACAGTTGGC
P6 lspA2 5120–5141+TTGAATTCGTGCTCCAGAAGCTATTGAAGCP6-P7/534
P7 lspA2 5653–5633TTTCTCGAGAAATTTTCAAAACTAACGCCCG
P8 pal 151–173  +GCACCAGCATTTGTATTAACGGCP8-P9/354
P9 pal 505–485  CGGTTGAAACTTGGCTAACGC
P10 lspA1 3270–3295+TTGAATTCAAGTTTCAGCAGGGACAGCAAATATCP10-P11/264
P11 lspA1 3534–3513TTTCTCGAGTCTAATTTTTCGGCGACAAGG
P12 lspA2 2852–2870+AAGTTTCAGCAAGAGCGGCP12-P13/320
P13 lspA2 3172–3155TATTGGCTGCAAGCTCTG
  • a NA, not applicable.

  • b This primer set binds equally well to thelspA1 and lspA2 sequences indicated within a region of absolute identity between these two genes.

  • c P1 is a probe; P2 through P13 are primers.