Table 1.

Peptide synthetase gene consensus and specific PCR primers

Primer (annealing) temp Degeneracy (fold)Tm (°C)Product (bp)Oligonucleotide primer sequence, from 5′→3′ (conserved peptide motif)
PS-PCR (52°C)
 MTF251253∼1,000GCNGG(C/T)GG(C/T)GCNTA(C/T)GTNCC(AGGAYVP, core motif I)
 MTR19251∼1,000CCNCG(AGT)AT(TC)TTNAC(T/C)TG(QVKIRG, core motif V)
MS-PCR (50°C)
 FAA150758CTATGTTATTTATACATCAGG
 RAA150758CTCAGCTTAACTTGATTATC