Table 2.

Primers

PrimerNucleotide sequence (5′-3′)
  1 CCCGCGGCCGCGATATCCTTTGTCAGTAACATGC
  2 CCCGCGGCCGCGGATCCTGTGGCGTTGAAGATCCG
  3 CGCTGAGCAATGACATCCG
  4 AATGTCACCCTGAAGCAGG
  5 GGGAAGCTTGCGGCCGCTTAGCAGGCTGGCTGGG
  6 GGGAAGCTTGCGGCCGCAAAGGTGGCGGCAACAC
  7 GGGAAGCTTGCGGCCGCTTAGCAGCTGGCTGGG
  8 GGGAAGCTTGCGGCCGCAAAGGTGGCGGCAACAC