Table 2.

Primers

PrimerNucleotide sequence (5′-3′)
  1CCCGCGGCCGCGATATCCTTTGTCAGTAACATGC
  2CCCGCGGCCGCGGATCCTGTGGCGTTGAAGATCCG
  3CGCTGAGCAATGACATCCG
  4AATGTCACCCTGAAGCAGG
  5GGGAAGCTTGCGGCCGCTTAGCAGGCTGGCTGGG
  6GGGAAGCTTGCGGCCGCAAAGGTGGCGGCAACAC
  7GGGAAGCTTGCGGCCGCTTAGCAGCTGGCTGGG
  8GGGAAGCTTGCGGCCGCAAAGGTGGCGGCAACAC