Table 2.

Primers used

PrimerSequenceaEnzyme(s) cutRegion boundb
OL995′AAAAACTCGAGCATATGTTTCGATTGTTTCAC3′XhoI and NdeI1 to 18
OL1095′AAAAAAGCTAGCAGCGGTGTTTCTTCTGCGTG3′NheI−332 to −351
OL1105′AAAAAAGCGGCCGCCCTCCAACTAAAGCTAATCCTAGTG3′NotI1424 to 1448
OL1165′AAAAAAGCTAGCATGTTTCGATTGTTTCAC3′NheI1 to 18
OL1315′AAAAAAAGCTAGCGATCATCATGCTGTCACCCT3′NheI−261 to −280
OL1325′AAAAAAAGCTAGCCTTTCTTTGTTTATTATTACC3′NheI−242 to −262
OL1335′AAAAAAAGCTAGCGGGATATGCATTTAAATTCTCAC3′NheI−209 to −233
OL1345′AAAAAAAGCTAGCATGAGCGATTTCGGTGTTTTT3′NheI−94 to −114
OL1355′AAAAAAAGCTAGCATTGTCATATCAAGT3′NheI−26 to −42
OL1365′AAAAAAAGCTAGCTCAAGTTACAGTGTTTTACAGGAG3′NheI−7 to −32
  • a The restriction endonuclease site(s) in each oligonucleotide is underlined. For OL99, the XhoI site is singly underlined and the NdeI site is doubly underlined.

  • b Region of the chromosome bound by the oligonucleotide, indicated as nucleotide positions relative to the start of the yqxM open reading frame.