Table 1.

Oligonucleotides used for PCR amplification

H. pylorigenePrimerSequenceaPositionStrand
fliD fliD/NNdeI ggaattccatATGGCAATAGGTTCATT 853–869+
fliD/CBamHI cgggatccTTAATTCTTTTTGGCCGC 2893–2910
fliDseq#2 GATATTTTTAGCCAAGTGG 1216–1234+
fliDseq#4 TTCTTATAGCGTGCATACGG 2457–2476+
fliDseq#5 TCTAAAGCCTGCTGTATCGC 1621–1640
ureAb UA5 TTGATGCTCCACTACGCTGG 2689–2708+
UA3 GGGGTATGCACGGTTACGAG 2935–2954
UALP CACCCCAAAAGAGTTAGATA 2667–2686+
UARP ATGTCTAAGCGTTTACCGAA 3142–3161
  • a Lowercase letters indicate sequences not homologous to the H. pylori sequence. Underlined nucleotides represent the NdeI (fliD/NNdeI) andBamHI (fliD/CBamHI) restriction sites used to clone the PCR product.

  • b The nucleotide sequence accession number isX57132 (21).