Table 2.

Primersa

OligonucleotideSequenceRestriction endonuclease(s)Nucleotide positions
OL915′ AAAAAAAAACTCGAGCTGATCAGCTTCATTGCT 3′ XhoI741–758
OL925′ AAAAAAAAACATATGTGCTTACAATTTTTC 3′ NdeI99–114
OL995′ AAAAACTCGAG CATATGTTTCGATTGTTTCAC 3′ XhoI/NdeI1–18
OL1105′ AAAAAAGCGGCCGCCCTCCAACTAAAGCTAATCCTAGTG 3′ NotI1424–1448
OL1155′ AAAAAAGCGGCCGC ATGCTGAACGTGTTGAAATCACGAC 3′ NotI/SphI808–818
OL1165′ AAAAAAGCTAGCATGTTTCGATTGTTTCAC 3′ NheI1–18
  • a The restriction endonuclease site(s) in each oligonucleotide is underlined (or in boldface), and the enzyme that cuts it is listed. For OL99, the XhoI site is underlined and the NdeI site is in boldface, and for OL115, the NotI site is underlined and the partially overlappingSphI site is in boldface. The region of the chromosome bound by each oligonucleotide is indicated as nucleotide positions relative to the start site of the yqxM open reading frame (9).