Table 2.

Oligonucleotides used in this study

Primer Sequence
pupp1-1CCCCGAATTCATCGATCCTAGCTCCATTTTTAA TCAAG
pupp1-2CCCCTCTAGATAAGGAATGATAACCAGTTC
pupp2-1CCCCGAATTCATCGATCCTAGCTCCATTTTTAA TCAAG
pupp2-2CCCCATCGATAAGGAATGATAACCAGTTC
1211GTAAAACGACGGCCAGT
orf8PstIAAAACTGCAGGGTCAGCAAGAATCGCAC
pAK80TCCTTTCAAAGTTACCC
pAK80ermTTTCAACTGCCTGGCAC
pattB-R1AAATGCACTGTTTGAGTC
pattBR-L1GATGATTGTCTTATTGTA
pattP-L1GATGAACTATGGGACCAAA
PB2GCTGCTTAAAGCTAAGATT
pattBLCTACTGCTGCTTCACCAG
BI-POB1invGTATGCAGCGATGTCGTTACCC