Table 2.

Primers used in this study

Primer no.Nucleotide sequence (5′–3′)
1CCCGCGGCCGCGAATTCGTGACTGATGCCCTCCC
2CCCGCGGCCGCGGATCCTGTGGCGTTGAAGATCCG
3CGCTGAGCAATGACATCCG
4AATGTCACCCTGAAGCAGG
5GGGAAGCTTGCGGCCGCTTAGCAGGCTGGCTGGG
6GGGAAGCTTGCGGCCGCAAAGGTGGCGGCAACAC
7GGCGTCGACGACCGATTGAGGTTTCC
8GCGCGGATCCGTTAAATCAAACCTCTTC