Table 1.

Oligonucleotides used in this study

PrimerCharacteristicSequence
A tprconserved senseCGACTCACCCTCGAACCA
B tpr conserved antisenseGGTGAGCAGGTGGGTGTAG
C tprD2-specific senseCACTAGTCTTGGGGACACGC
D tprD2-specific antisenseTACGTGAATTGCAACCAGGA
E tprA-specific senseTACCTACCGGGATACGAACAGT
F tprA-specific antisenseTGCAAGGCATGGGTGTAATCAT
G tprD2 antisense 2TGACTTCATGGACCCTCTGTG
HTp0130 antisense bp 45–66CATGGCATTGGTGAGAAAGACG
ITp0132 sense bp 137–157CGCGTACCGCTTTGCAGTTCA