Table 2.

Oligonucleotides (5′→3′) used in this study

1. kan 5′ +NdeICATATGAGCCATATTCAACGGGAAACG5′kan fusion with Borrelia promoter
2. pOK.3GATCGCCCTTCCCAACAGTTGC3′ end ofkan gene 3. 
3. flaB 5′ prom +NotITGTCTGTCGCCTCTTGCGGCCGCCGGAGGAG5′ end of flaB promoter
4. flaB 3′ prom +NdeIGATTGATAATCATATGTCATTCCTCCATGflaBpromoter 3′ fusion with kan
5. flgB 5′ promTAATACCCGAGCTTCAAGGAAG5′ end of flgB promoter
6. flgB 3′ prom +NdeICTTTCAAAATCATTCATATGGAAACCTCCCTCflgBpromoter 3′ fusion with kan
12. pOK.6ATGCAAAAGCACCACTGGCAGCSequencing promoter fusions
13. FL-6TTCAGGGTCTCAAGCGTCTTGGACTflaBgene-specific probe
14. FL-7GCATTTTCAATTTTAGCAAGTGATGflaBgene-specific probe
17. pOK12-Rev2TGTGGAATTGTGAGCGGATAACScreen foroppAV integrants
18. oppA.73GCGTCTTTTTAAGCCTTTTGCCScreen foroppAV integrants
  • a Restriction sites in boldface.