Table 2.

Oligonucleotides (5′→3′) used in this study

OligonucleotideSequenceaApplication
1. kan 5′ +NdeI CATATGAGCCATATTCAACGGGAAACG5′kan fusion with Borrelia promoter
2. pOK.3GATCGCCCTTCCCAACAGTTGC3′ end ofkan gene 3. 
3. flaB 5′ prom +NotITGTCTGTCGCCTCTTGCGGCCGCCGGAGGAG5′ end of flaB promoter
4. flaB 3′ prom +NdeIGATTGATAATCATATGTCATTCCTCCATG flaBpromoter 3′ fusion with kan
5. flgB 5′ promTAATACCCGAGCTTCAAGGAAG5′ end of flgB promoter
6. flgB 3′ prom +NdeICTTTCAAAATCATTCATATGGAAACCTCCCTC flgBpromoter 3′ fusion with kan
7. flaB 5′ prom +NgoMIV GCCGGCTGTCTGTCGCCTCTTGTGGCTTCCGGpJLB 500A
8. flgB 5′ prom +NgoMIV GCCGGCTAATACCCGAGCTTCAAGGAGpJLB 500G
9. pOK.7 +NheIGGCGAATGAGCTAGCGCCGTCCCpJLB 500A and -G
10. pOK.8 +NheIGGGACGGCGCTAGCTCATTCGCCpJLB 500A and -G
11. pOK.9 +NgoMIV GCCGGCGACAGTTTTATTGTTCATGATGpJLB 500A and -G
12. pOK.6ATGCAAAAGCACCACTGGCAGCSequencing promoter fusions
13. FL-6TTCAGGGTCTCAAGCGTCTTGGACT flaBgene-specific probe
14. FL-7GCATTTTCAATTTTAGCAAGTGATG flaBgene-specific probe
15. oppA.76CGTGCTCAGCAATGTCTAAAC5′ ΔoppAV
16. oppA.83CATGTTTCAGGCTCAATTTCTAC3′ ΔoppAV
17. pOK12-Rev2TGTGGAATTGTGAGCGGATAACScreen foroppAV integrants
18. oppA.73GCGTCTTTTTAAGCCTTTTGCCScreen foroppAV integrants
  • a Restriction sites in boldface.