Table 3.

Variation in DR sequences

DVR type   Sequencea
Consensus sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
DVR26 ----TCAGACCCAAAACCCCGAGAGGGGACGGAAAC
DVR31 GTCGTCAGACCCAAAACCCCGAGAGAGGACGGAAAC
DVR47 GTCGTCAGACCCAAAACCCCGAGAGGGGACGTAAAC
DVR50 GTCGTCAGACCTAAAACCCCGAGAGGGGACGGAAAC
DVR65 GTCGTCGGACCCAAAACCCCGAGAGGGGACGGAAAC
DVR67 GTCCTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
DVR68 GTCGTCAGACCCAAAACCACGAGAGGGGACGGAAAC
  • a Polymorphisms are indicated in boldface.