Table 2.

Oligonucleotide primers used in this study

Primer no.aDesignationSequence (5′→3′)Gene
1rpoSfla-F1TCCATCGTCAGCAAACACAGG pdxK(BB768)
2rpoSfla-F2TGTTCGATGTTTGGACCTCC gcp(BB769)
3BB770-F1TGTTTCCTCGTAAAGATTTAATAAGTTGTCBB770
4BB770-B1GGATAAAAAAGCCAAAAGCAAACCBB770
5rpoS-F1CCTATTTTTAAGTGGGGCATTTGCBB770
6rpoS-F3GGTGCTTTTTTTGGGACTATTG rpoS (BB771)
7rpoS-B3GCAGGACAAATACAAAGAGGC rpoS (BB771)
8rpoS-B1AATTGGCACAGTTTTTGCATGG5′-rpoS
9rpoSfla-B2TTAAGGTAAAAAGCAACAATTCATACBB773
10rpoSfla-B1ATCCAAAACTCAATTACAATATCTGAAGAG5′-flgG
11U178+BglIIACCAGATCTTGTTGGTTTTAGCACTATA5′-gyrBr
12246RCTCTTCATGAATATCGGTAGG gyrBr
131580RTTATAAAGAGGAGGCATGGC gyrBr
141696FCTTCAGAGATATAAAGGGCTTGGG gyrBr
151905R+BclIACCTTGATCATTACACATCAAGATTAATTAC gyrBr
16Fl6TTCAGGGTCTCAAGCGTCTTGGACT flaB
17Fl7GCATTTTCAATTTTAGCAAGTGATG flaB
  • a The numbers refer to the relative positions and orientations of primers in the rpoS flanking region and gyrBr given in Fig. 1.