Table 1.

Bacterial strains, plasmids, and oligonucleotides

Bacterial strain, plasmid, or oligonucleotideRelevant characteristicsReference
Strains
E. coli
  DH5αλφ80d/lacZΔM15 Δ(lacZYA-argF)U169 recA endA1 hsdR17(rK mK +)Laboratory stock
  CJ236Camr(pCJ105) dut ung thi relA; used for site-directed mutagenesisLaboratory stock
A. tumefaciens
  A136Strain C58 heat cured of its Ti plasmid 28
  A348A136 containing octopine pTiA6NC 28
  A348ΔB1A348 with a precise, nonpolar deletion ofvirB1 from pTiA6NC 7
  C58A136 containing the nopaline Ti plasmid pTiC58Laboratory stock
  CB1001C58 with a precise, nonpolar deletion of virB1 from pTiC58 45
Plasmids
 pBCSK+.NdeICamr; source of polylinker for pBP21 7
 pBP2NStrr Spcr; BHR vector carrying the nopaline virB promoter followed by a uniqueNcoI site containing the ATG start codonThis study
 pBP21Strr Spcr; BHR vector carrying the nopaline virB promoter followed by the polylinker from pBCSK+.NdeIThis study
 pGV0310Crbr; carries three consecutiveHindIII fragments of pTiC58 that include the entirevirB operon in pBR322; template for PCR amplification of thevirB promoter 19.
 pMTX100Crbr; pUC119 carrying a 1.9-kbpHindIII fragment of the virB operon that includes virB1, virB2, virB3 and part of virB4 This study
 pMTX106StrrSpcr; vir-regulated expression of full-length nopaline virB1, in pBP2NThis study
 pMTX107Strr Spcr,vir-regulated expression of nopaline virB1 * fused to the coding sequence for the signal peptide, in pBP2NThis study
 pMTX110Strr Spcr;vir-regulated expression of the signal peptide N-terminal segment of nopaline virB1 with a six-His tag, in pBP2NThis study
 pMTX122Strr Spcr; similar to pMTX107, with a smaller deletion in the lysozyme-homologous region in pBP2NThis study
 pMTX124StrrSpcr; vir-regulated expression of full-length octopine virB1, in pBP21This study
 pMTX128Strr Spcr;vir-regulated expression of nopaline VirB1 without the signal peptide in pBP2NThis study
 pMTX129Spcr; vir-regulated expression of nopaline virB1 * without the signal peptide in pBP2NThis study
 pPZP200Strr Spcr; binary vector, source of E. coli and pVS1 BHR origins of replication for pBP2 and pBP21 30
 pSW213Tetr; IncP BHR plasmid containinglacI q and plac with downstream polylinker sequence 11
 pSW213:virB1 Tetr; full-length VirB1 cloned behind the plac promoter using HindIII and PstI sitesThis study
Oligonucleotides
 BP55′-GGCCTGATCATCGCTGAGCTCGGACATAGG-3′; 5′ primer for PCR amplification of the virB promoter from pGV0310
 BP3Nco5′-GGCCAGTACTCCATGGCCCATCTCCCCAAGCTCATAA-3′; 3′ primer for PCR amplification of the virB promoter from pGV0310
 C-His5′5′-GCATCATCATCATCATCATTAGAGATCT-3′; 5′ primer for introducing a six-His tag at the C terminus of VirB1 followed by a stop codon and a BglII site
 C-His3′5′-AGATCTCTAATGATGATGATGATGATGC-3′; 3′ primer complementary to C-His3′
 MTX45′-CCACTTTCATTTGCTGCTCAACAGCTCGTC-3′; used in site-directed mutagenesis of pMTX100 to delete coding sequence for amino acids 29 to 172 of VirB1 to produce VirB1* translationally fused to the signal peptide for pMTX107
 MTX55′-GGACAACATGTTGAAGGCAACAG-3′; 5′ primer for amplification of nopaline virB1, Met codon is within anAflIII site
 MTX65′-GGACAAGTACTATTGCGGACCTCCT-3′; 3′ primer for amplification of nopaline virB1 with aScaI site
 MTX195′-GGAAGCTTGAGCTAAGGAGATAAGG-3′; 5′ primer for PCR amplification of octopine virB1, includesHindIII site and ribosomal binding site upstream of the start codon
 MTX205′-GAACTGCAGCTCCTTAGTATAAGTCGA-3′; 3′ primer for PCR amplification of octopine virB1, includesPstI site after the stop codon
 MTX215′-CTTCCCATGGCTCAACAGCTCGTC-3′; 5′ primer for PCR amplification of virB1 * lacking signal peptide coding sequence, ATG within an NcoI site is inserted in front of amino acid 173
 MTX225′-CCTTCCATGGCTCCATCCGTTGCTC-3′; 5′ primer for PCR amplification of virB1 lacking the signal peptide coding sequence, ATG within an NcoI site is inserted in front of amino acid 29
 VirB1-5′TGACAAGCTTGGGGAGATGGGGA; 5′ primer for PCR amplification of virB1 with aHindIII site upstream of the coding sequence
 VirB1-3′GCGCGAATTCATTGCGGACCTCCTTGATT; 3′ primer for PCR amplification of virB1 with an EcoRI site at the 3′ end of the coding sequence