Table 1.

Strains and plasmids used in this study

Strain or plasmidCharacteristicsaSource or reference
E. coli
 DH5α-MCRF lacZΔM15 recA1 hsdR17 supE44 Δ(lacZYA argF)Bethesda Research Laboratories
 SM10Kmr, mobilizer strain 19
P. aeruginosa
 PAO1Prototrophic, wound isolate 8
 PAO1 Δohr::TcTcr, PAO1 harboring a 516-bp deletion of the ohr locusThis study
 PAO1 ΔahpCF::GmGmr, ΔahpCF::Gm mutant of PAO1 13
 PAO1 ΔoxyR::GmGmr, ΔoxyR::Gm mutant of PAO1This study
 PAO1 Δohr ΔahpCF Gmr Tcr, Δohr ΔahpCF double mutant of PAO1This study
 PAO1 ΔahpA ΔahpB Gmr, Tcr, ΔahpA ΔahpB double mutant of PAO1This study
Plasmids
 pCRII-2.1Apr Kmr TA cloning vector for PCR fragmentsInvitrogen
 pCRII-ohr-220pCRII-2.1 containing a 220-bp 5′ohr portion generated with primers CCAACGATTTGTCTTGCGCAC and ACCTGTCTGATTTGTACGTTAAG; source of T7-expressed ohr riboprobeThis study
 pCRII-omlA-444bpCRII-2.1 containing a 444-bp omlA promoter fragment; source of T7-expressed omlAriboprobe 12
 pEX100TApr oriT mob sacB 18
 pEX100T-Δohr::TcpEX100T containing a Δohr::Tc cassette; used for deleting ohrfrom bases 203999 to 204505This study
 pPZTCApr, pPZ30-based broad-host-range vector used for transcriptional lacZ fusions 17 and this study
 pOHR593pUCP22 containing the ohr gene and ohr promoter, from bases 203847 to 204439This study
 pPZ-Pohr pPZTC containing portions of the ohr promoter as indicated in Fig. 5; series ofohr-lacZ fusionsThis study
 pUCP22Apr, multicopy broad-host-range expression vector 23
  • a mob, mobilization site;oriT, origin of transfer (RK2); sacB, encodes a levansucrase; Apr, ampicillin resistance; Kmr, kanamycin resistance; Gmr, gentamicin resistance; Tcr, tetracycline resistance.