Table 1.

Primers

PurposePrimerSequence
Amplification of the internal gene fragments (5′-3′)GlpQ1CTAATACGACTCACTATAGGGAGAGTAAGGATGAAGCAGGAGG
GlpQ2GTTCTGTCGCTGGGCTTAC
YdhF1CTAATACGACTCACTATAGGGAGAAAGACGTCACTTGTCGTG
YdhF2GCTATCATGCTTGCGGGC
YjbC1CTAATACGACTCACTATAGGGAGATTTCTTCATCGATGATTTCC
YjbC2CAATGAACTGGTATGAAAAG
YfhM1CTAATACGACTCACTATAGGGAGAAGATGAGATGTCCATTCGG
YfhM2AAGTGGACGGAGTTAAATGC
YxiE1CTAATACGACTCACTATAGGGAGACTTTATGGCTGACGCTTCC
YxiE2ATGTTAGTAGCGATTGACG
Amplification of the promoter regions (5′-3′)GlpQvorCCCAAGCTTGGGAACGGCGGCTTTATCATG
GlpQrevCGGGATCCCGGTAAGGATGAAGCAGGAGG
YjbCvorGCAGGAAGTTATTCCCGAGC
YjbCrevCATCGATGATTTCCAAGACCTC
Sequencing and primer extension reaction (5′-3′)GlpQ-PETGCCGACACTGGCGTTACC
YjbC-PETCAATTGGAAAGTACTCGCTAAGC