Table 2.

PCR primers used to amplify urease genes

P. mirabilis geneForward primerReverse primer
ureA 5′ AGCAGTAATGGAATTCACAC 3′5′ GATCAGCTCGAGACCTACAC 3′
ureB 5′ ACTCGAATTCTGTGTAGGTA 3′5′ TAAGCTCGAGGTGTGATAGT 3′
ureC 5′ ATGGAATTCACCTCACGTCA 3′5′ CTCACTCGAGACGCTGGTTA 3′
ureD 5′ AAGTTGGAATTCGTGGGTATG 3′5′ CCATCTCGAGTCCTAAAATAAAC 3′
ureE 5′ AACGGAATTCTTTACTCAG 3′5′ TGCGAATTCTTGGATGATC 3′
ureF 5′ TGGGAATTCGATCATCAAAG 3′5′ TGGGGAATTCTGGCGATCAC 3′
ureG 5′ TGAGAATTCGTGATGCAAGA 3′5′ ACCCATACTCGAGCTCATAG 3′