Table 1.

Primers used in this study

NameNucleotide sequenceaLocationbComments
SEQ3-FATNTTYGGNMGNACNTAYATGAAYYTInitially unspecified cohesinDegenerate primer derived from initial protease digest of candidate scaffoldin
CBD-RTGWKYRWARTTWSWCCAGTCCBDDegenerate primer designed on the basis of known family III CBD sequences
En-FTTRTCNACRTCRAADATCCAN terminusDegenerate primer that aligned with N-terminal portion of signal sequence
24C-RCATATTCAGGAGCTGATGCATCoh-2To amplify N terminus of CipBc
24N-RTTTTCTGCTGCTCCAGAATTCCoh-2To amplify N terminus of CipBc
H706N-RGTCTGTGATGGTGGTAGTGALinker between Coh-3 and Coh-4Sequencing
H706N-FATTGGTTCAGGTGTAACAGCLinker between Coh-3 and Coh-4Sequencing
COH-FnCAGCTCGAGGGTTCAGGAGTAGTATCAACTCoh-5Cohesin expression
COH-RnGTGGATCCTTACTATCCGTTTATTGAAGAAGCCTGCoh-5Cohesin expression
COH-FAGACCATGGGTTCAGGAGTAGTAGCAACCoh-5Cohesin expression
COH-RAGTCTCGAGTCCGTTTATTGAAGAAGCCTGCoh-5Cohesin expression, inverse PCR
12F1TTAACAGCGACTTGAAGTTCBDInverse PCR, sequencing
12R2AGCTTGCTGCTGCACCATTCBDInverse PCR, sequencing
12R1GATCATATGTTGATGATCCTGCBDInverse PCR, sequencing
12F2CAATTCAGGGTAGAGTTGCACBDInverse PCR, sequencing
SC-FGGTTCAACATCCATTAAGTTAGCoh-6Genomic-walking PCR
3601-FATGGAGTTCAGTTGGACAATCoh-7Sequencing
4041-FACTGAAACTAAAGTATTATTGAACoh-8Sequencing
C-R2CAACAACTGGAGCATTAACTLinker between Coh-10 and Coh-11Genomic-walking PCR
C-R1ATCATTATCAATAGCTGTCAACoh-11Genomic-walking PCR
C-F1TCACAAGGTGTATTGAACTTCoh-11Genomic-walking PCR
C-F2GAACCTTTCAGCATACAGAGCoh-11Genomic-walking PCR
M13-R1AGCGGATAACAATTTCACACAGGApUC19Genomic-walking PCR
M13-R2AACAGCTATGACCATGATTACGpUC19Genomic-walking PCR
M13-F1GTTTTCCCAGTCACGACGTTGpUC19Genomic-walking PCR
M13-F2TGTAAAACGACGGCCAGTpUC19Genomic-walking PCR
  • a Abbreviations for degenerate nucleotides: K, G or T; Y, C or T; W, A or T; R, A or G; S, C or G. N represents A, C, G, or T.

  • b The exact locations of relevant primers are shown in Fig. 3.