Table 1.

DNA oligonucleotides used in this study

PrimerSequence (5′→3′)a
YC42FAACSTGCCTKCTTATYTCCTA
YC42RCGGAACACTCAACATACTTKA
5′42WDCAGTCGACACCGCTACCCATCT
3′42WDACGATATCCCTGACACGATCCATT
5′42ACGTCCGCTATTCATCTTCTAT
5′42KpnATGGTACCTGCGGGTATGACAAAGGTC
3′42HindTAAAGCTTACTTCGCCAGCATCGTTTGA
3′42CTCGTTTGGGTCAGACTTTCTTG
42-14VGCCGACCGCGACGTCACCG
N-19NCGGTCGGCAAGAACTGCTTGCTGATATCGTACACCACC
42-120CTCAGACCGCTCTACGTGAC
42-186I7NCCACCAAAGAAGAATATTAAGAAATGCACG
42BglAAAGATCTACGGAATGGTTGTCGCAACG
42XbaAATCTAGACCGAGTCTCATCAAAGAATCGT
  • a Sequences for restriction endonuclease recognition sites are in italics. For mutagenic primers, sequences changed from the original DNA sequence of W. dermatitidisare underlined.