Table 1.

Oligonucleotides used in PCR, primer extension, and hybridization analyses

SpecificityOligonucleotideSequence (5′ → 3′)
sbsA T7-SAATAAGGATCCGATGAAGCTGCGCTTACTC
32AGCTGTTGCTAGTTTCACA
32A-STATAAAGCTTGCTGTTGCTAGTTTCACA
E1CCTTGCGCGGTGACAAACACC
H4iTACCAACCAAACAGGC
M15TGTTCCATTCCATGAACC
NTGAACTGTGCTTTTGCTTGG
NTGi1ATTTTTTTCAGAGATTTCGTCAATACTTT
NTNNGCTACAGATGTAGCAACAGT
RP1GTCTTCAATTCACAACAACG
P6-UP1ATCGGAATTCAGGCGAACCGTTCGCCAT
RPG1AGTAGGAGCGGTAGCAAC
sbsB LISC2AAAATATATCAACTCTG
LIS-iGTGCACTATTGCCGCTATC
NIS3AGCGGTTAATTCGACTA
NIS1A-GCTGCGCATCTAGACGAGT
P2-extATAGGACTTAGGTTGAT
P2-Up2TTGTATAATTTCTTTTATG
SbsB-CATGCACCTCTCAACAATTC
UP62CTAAAGTTACAGCTGTAAAACCG