Table 1.

Predicted genes and gene products of bacteriophage φYeO3-12

GeneGene productSD sequencebProtein nameIdentity with:Function(s)
NameRange% G+CSize (aaa)Molecular mass (kDa)pIT3 (%)T7 (%)Other (accession no.)
0.3 1035–1490 52.1152 17.0 7.72ACATGAGGTAACACCAAATG gp0.3 98.0 20.9SAMase (adometase)
0.45 1558–1755 44.4 66 7.5 7.36CTTATAGGACTAACACCATG
0.6a 1758–1958 45.0 67 7.911.33 GGTGGAATGACTAATG gp0.6A34.0
0.6b 1758–2115 46.2 120 14.011.70 GGTGGAATGACTAATG gp0.6B25.2
0.7 2133–3239 53.6 369 42.27.84 ACAGGACACTGAACGATG gp0.751.4 Protein kinase
1 3313–5964 53.6884 98.8 7.32 CAATGAGGTAAGCAATG gp1 99.1 82.4 RNA polymerase
1.05 6054–6323 45.7 90 10.4 10.04CTAAGAGATTAAATTTATG gp1.05 97.8
1.1 6419–6556 53.3 46 5.9 11.57ACATGAGGTAAGATACTATG gp1.1 97.845.0
1.2 6562–6834 51.5 91 10.58.45 AGTGGAACTAATAATG gp1.2 94.540.0 Deoxyguanosine triphos-phohydrolase inhibitor
1.3 6933–7970 51.1 346 39.4 4.94CAATGAGGAACAACCGTATG gp1.3 95.473.5 DNA ligase
1.45 7903–8373 49.5 15717.7 10.36 TATGGAGGAAACACCTGATG e20 Phage bIL170 (AF009630)c HNH endonuclease homologue
1.5 8392–8466 46.725 2.8 3.33 ACAGGAGACACACACCATG gp1.5 96.0 37.5
1.6 8482–8736 53.785 9.9 11.78 TAAGGAGACAACATCATG gp1.6 98.8 57.6
1.7 8739–9206 52.1156 17.7 10.08 TAAGGAGGTGCTGTAATG gp1.7 82.147.7
1.8 9196–9330 55.6 45 5.34.97 ACCGGGGGCTGTGTTATG gp1.893.0 32.4
2 9330–9563 52.7 78 8.94.69 TAAGGAGGCCAATAAATG gp2 85.239.1 Bacterial RNAP inhibitor
2.5 9619–1031452.2 232 26.0 4.62AAAGGAGAAACACTATG gp2.5 98.385.5 Single-stranded DNA- binding protein
3 10317–10776 49.1 153 17.6 10.28GGAAGAGGACTTCTAATG gp3 93.4 84.6Endonuclease
3.5 10771–11223 53.0 151 16.99.29 AAAGGAGTAAAGAAAAATG gp3.596.7 91.4 N-Acetylmuramoyl-l-alanine amidase (lysozyme)
3.7 11231–11335 48.6 35 4.2 8.18GACCGAGGGTGATACCATG gp3.7 97.1
4a 11406–13103 50.8 566 63.0 4.90TAAGGATTAACCACATG gp4A 95.6 82.4Primase-helicase
4b 11592–13103 51.1 50455.9 4.98 ACAGGAGGCAGCAAGCCTATG gp4B 99.2 84.7 Helicase
4.15 11672–1177656.2 35 3.9 11.24CTCGAAGGAGACATG
4.2 12826–13152 49.8 109 12.0 7.58GGAGAAGGGAAAAGCACATG gp4.2 83.537.6
4.3 13202–13411 48.1 70 7.710.80 ATAGGAGACACACCATG gp4.397.1 41.4
4.5 13427–13708 55.0 9410.8 10.69 TAAGGAGCGCACACTATG gp4.5 96.8 56.2
5 13779–15890 51.0704 79.8 6.77 AAAGGAGGGCATTATG gp5 87.1 85.6 DNA polymerase
5b 14739–15890 51.6 384 42.9 7.01ACACGAGGGATTACATG gp5B 89.8
5.3 15903–16232 50.3 110 13.010.05 TAAGGAGGATTTATG gp5.3 91.125.0
5.5 16213–16515 49.7 101 11.27.56 AAAGGAGAAACATTATG gp5.554.1 44.9 Growth on lambda lysogens
5.5–5.7 16213–16721 50.9 171 18.6 9.72AAAGGAGAAACATTATG gp5.5–5.7 67.961.9
5.7 16515–16721 52.7 69 7.310.53 GCGAGAGGTGTTCAAATG gp5.788.4 87.0
5.9 16721–16900 48.3 606.8 3.76 ATGGGAGGTTGCGTATG gp5.932.7 32.7
6 16900–17808 52.1 30334.8 4.77 CGGGGAGGATGACGAATG gp679.5 73.0 Exonuclease
6.1 16937–17164 52.276 9.1 12.23 CGCGGAGATGCGTG
6.3 17793–17903 55.9 37 4.210.48 CAAGGAGATTTACTTATG gp6.397.3 26.5
6.5 17999–18241 47.7 819.4 6.26 TTAAGAGGTGAAATTATG gp6.5 98.8 55.6
6.7 18249–18497 52.283 8.9 9.79 ACAGGAGTAATTATATG gp6.7 98.8 63.6 Adsorption
7.3 18528–1884552.5 106 10.9 10.56TAGGGAGAAACATCATG gp7.3 95.366.0 Host specificity
8 18859–20463 51.3535 58.6 4.37 TGAGGAGGACTGAATG gp8 99.1 84.6 Head-tail connector
9 20568–21497 51.7 310 33.7 4.13TTAGGAGATTTAACAATG gp9 94.8 64.3Scaffolding protein
10a 21657–22697 55.9 34736.9 6.74 TAAGGAGATTCAACATG gp10A 99.1 80.5 Major capsid protein
10b 21657–22954 55.2 433 45.4 6.74 TAAGGAGATTCAACATG gp10B 98.473.7 Minor capsid protein
11 23191–23778 50.5196 22.2 4.31 ACAGGAGGTAACATCATG gp11 80.1 Tail protein
12 23797–2619950.2 801 89.9 6.35CAAGGAGGCTCTATG gp12 69.7Tail protein
13 26275–26688 43.5 138 16.15.73 ACGAGGGGTTAAAGCATTATG gp1355.1 Internal head protein
13.5 26688–2707450.8 129 14.6 8.72CAAGGAGGAACCCTTG gp59 Phage L5 (Q05272)d T4 endonuclease VII homologue
14 27080–27670 53.3 197 21.3 10.16AGAGGAGAATAATTATG gp14 68.9Internal core protein
15 27676–29916 51.2 74785.3 5.51 CGGGGAGGTAATAATG gp1566.7 Internal core protein
16 29938–3389752.0 1320 143.6 9.10 TAAGGAGGCTCCATG gp16 67.2Internal core protein
17 33972–35906 50.2 64569.4 6.33 AAAGGAGGTCACATG gp171–645 37.7 40.0 Tail fiber protein (adsorption)
gp171–150 78.7 78.7
gp17150–645 22.5 24.7
17.5 35962–36162 47.3 677.4 6.75 ATAGGAGGACACAATG gp17.585.1 91.0 Holin for cell lysis
18 36169–3643252.3 88 9.86 4.54 TAAGGAGTAACCTATG gp18 71.6 71.6DNA packaging, small subunit
18.5 36526–36975 49.8150 17.0 10.16 ATGGGAGGTGTTATG gp18.5 53.8 56.0 Endopeptidase, λ Rz homologue
18.7 36641–36892 48.0 84 9.310.35 GAAGGAGGTAATCCAAAATG gp18.745.8 47.0 Cell lysis, λ RzI homologue
19 36953–38713 52.6 587 66.7 5.26 TAAGGAGATGCAGAATG gp19 95.9 84.5DNA packaging, large subunit
19.2 37602–37832 56.777 8.3 11.48 CTCGAAGATAACCGTG gp19.2 81.8 42.9
19.3 38139–38264 50.842 4.8 12.39 CTGGCGGGTTCCGTGATG gp19.3 92.8 59.5
19.5 38959–39105 50.349 5.5 8.11 AAAGGAGGTGGCTCAATG gp19.5 98.0 65.3
  • a aa, amino acid.

  • b SD sequence is indicated by underlining, and the initiation codon is indicated by boldface type.

  • c Identity, 43% (26 of 60 amino acids).

  • d Identity, 39% (41 of 105 amino acids).