Table 1.

Bacterial strains, plasmids, and mutagenic oligonucleotides

Strain or plasmidCharacteristicsReference or source
Strains
L. lactis
  NCDO2118 L. lactis subsp. lactis natural isolateNCDO
  JIM4460NCDO2118,aldB::tetM 19
  JIM5152NCDO2118, Emr, P3::lux on pJIM1754 integrated in the chromosomeThis work
  JIM5192NCDO2118, transconjugant with Tn916::P3::luxAB-ermfrom JIM5244This work
  JIM5470NCDO2118, Emr, P2::lux on pJIM2419 integrated in the chromosomeThis work
 Other species
  JIM5027 B. subtilis containing Tn916from Enterococcus faecalis This work
  JIM5244JIM5027, Tn916::P3::luxAB-erm by double crossover of pJIM2842This work
  TG1 E. coli, supE thi Δ(lac-proAB)hsdD5 F+ traD36 proAB lacI ZDM15 15
Plasmids
 pVE6004Emr thermosensitive derivative of pGKV12 30
 pVE6007Cmrthermosensitive derivative of pGKV12 30
 pBluescriptAmpr, M13 ori, pBR322ori Stratagene
 pJIM50018.5-kb XbaI fragment of L. lactis chromosome containing theleu-ilv-ald operon in pIL253 16
 pJIM5401.2-kb BamHI-EcoRI fragment of pJIM500 in pBluescript 19
 pJIM540Δ* pJIM540Δ (Δ = deleted byHindIII-PstI), amplified by PCR with P3mut3 and P3mut4, cut by NsiI, blunted by T4 polymerase and ligated; P3 contains the G-to-A and T-to-A substitutionsThis work
 pJIM2802Emr, contains P3::luxAB upstream of the erm gene in pJIM2367 39
 Integrative plasmids
  pJIM2374Emr, ORI(pWV01ΔrepA), integrative transcriptional fusion vector with the luxAB genes
  pJIM1754pJIM2374 with 0.564-kbBamHI-PstI fragment containing P3 from pJIM540This work
  pJIM2419pJIM2374 with 3.82-kbEcoRI fragment containing P2 from pJIM500This work
  pJIM2842pVE6007 containing tetM from Tn916; the 5.2-kb XcaI fragment containing terminator-P3-luxAB-erm cassette from pJIM2802 is inserted in HindII from tetM This work
 Plasmids for analysis of P3 promoter
  pJIM2367Emr, promoter probe vector with theluxAB genes 39
  pJIM2808pJIM2367 containingBamHI-PstI fragment from pJIM540This work
  pJIM2559pJIM2367 containing 171-bpBamHI-DraI fragment from pJIM540This work
  pJIM2560pJIM2367 containing 261-bpBamHI-HpaI fragment from pJIM540This work
  pJIM2562pJIM2367 containing 393-bpHpaI-PstI fragment from pJIM540This work
  pJIM2566pJIM2367 containing 148-bpAseI-AseI fragment from pJIM540This work
  pJIM2576pJIM2367 carrying a 150-bp PCR fragment obtained from pJIM2566 with P3mut1 and a plasmid oligonucleotide; the fragment contains the wild-type P3This work
  pJIM2589Like pJIM2576 with mutation in the P3 −10 extended box (Table 4)This work
  pJIM2596Like pJIM2576 with mutation in the P3 −10 extended box (Table 4)This work
  pJIM2586Like pJIM2576 with mutation in the P3 −10 extended box (Table 4)This work
  pJIM2591Like pJIM2576 with mutation in the P3 −10 extended box (Table 4)This work
  pJIM2593Like pJIM2576 with mutation in the P3 −10 extended box (Table 4)This work
  pJIM2594Like pJIM2576 with mutation in the P3 −10 extended box (Table 4)This work
 Plasmids for translational study of aldB
  pJIM781 XhoI-BamHI (PCR processed) PCR fragment containing the RBS and the beginning of L. lactis hisC C. Delome, personal communication
  pJIM1299Ligated AseI fragment from pJIM2566 andAseI-EcoRI fragment from pJIM540Δ*, amplified by PCR with oligonucleotide aldB1 and an oligonucleotide from the plasmid pJIM540; cloned in BamHI of pBluescriptThis work
  pJIM1711 BamHI PCR fragment of 113 bp amplified with oligonucleotides aldB1 and aldB2 from pJIM1299 cloned inBamHI of pBluescriptThis work
  pJIM1715Emr, transcriptional-translational fusion vector with luxAB fusion gene processed to introduce a NdeI site overlapping the ATG start codon 39
  pJIM1730pJIM1715 containing the 50-bp AseI-NdeI fragment from pJIM1299 inSpeI (T4 polymerase blunted)-NdeIThis work
  pJIM1732pJIM1715 containing theBamHI-NdeI PCR fragment from pJIM1711 inBamHI-NdeIThis work
  pJIM1735pJIM1715 containing the BamHI-NdeI fragment from pJIM1299 in BamHI-NdeIThis work
  pJIM1739pJIM1735 containing the XhoI (T4 polymerase blunted)-BamHI fragment from pJIM781 inSmaI-BamHIThis work
  pJIM1740pJIM1739 derivative with BamHI cut and filled by T4 polymeraseThis work
Mutagenic oligonucleotides
 P3mut1ATCGAATTCATTAATTAAATTAT(ACGT)T(AT)AAATTTCTAGTGa This work
 P3mut3GGGCATGCATTTAAAATAATTTAATTAATThis work
 P3mut4ACGGATGCATTTCTAGTGATTTAAAGAGThis work
 aldB1CCGGATCC ATATG ATTTCTCTTTCTATCTC; the ATG from NdeI is the start codon of AldBThis work
 aldB2GGGGATCCATTTTCTAGTTTCAATTCTCThis work
  • a The rules, boldface, and italics indicate the restriction sites designed in the oligonucleotide, the base changed compared to the wild-type sequence, and the start codon used for the translation of luxAB, respectively.